Clone Read LE_HBa0173M12_T7_105431

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0173M12_T7_105431
Primer
T7
ID from Seq. Facility
LE_HBa_173_M12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
519 trimmed for vector and quality, 800 raw
Sequence
>LE_HBa0173M12_T7_105431 (raw untrimmed)
CCTCGGACCCGGAGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAATTTTTTAAAATTCGTGTACTTTTTTGTGTGATGTTGAGAATGATTTGG
AGACTTGTTTCTTTTTTGTTGGTTTTTATCAAAATGGCTATCTTCTCATTTTCTAGTATGTAATTCACAGTGCATTAGAAACATTGTTGTGATAAGAGTT
ATGTGATAAGAGGATGTACCATTTCGAGGGTCGTATCGCTTGCCACGATGGAGATTATAATTCGAGGGATGTATCGCGCGCCGCAACAGTTACTACTGTC
GAGGTTCGTGTCGTGACCCGCAACAGATGCATGGACAAATATGTCCCCCATGGGTCCCAGACTGAGAGATAGCGGGTATGTATCGTTAGGGAAGACATGC
ATCACTATCCTTGACATTGCATCTCATGGCATTACACATTTTTATTATTTATGAACTTGAATACGTGGTTTGCTGATCTTGTTAGTGTTTACCCCCCAAA
ATTGTGACTGTTGAATATTGAGATGTTATTGAGAATATGTAAACTAATAGAGTGTGGTTAATGAGTAGTGATTTTGGTAAATTGATGAGTTGATTATAAT
GTAACATTAAAGATTTAGATTTTTATATTTTTTTTTTTTTTATTTTAAGTGGTGAATATAGAGTAAAGTTTATTTATTATATTGTAGTTGTAGAATTGGA
TTTTTATTAATTAAATAGTTATTATTATTTAGATAAGTCAAAAATTATTTTATTAATTTAGATGAATATTTTGGGTGTGTTATGGAGATGTATTATGATT

>LE_HBa0173M12_T7_105431 (trimmed for quality and cloning vector)
AGCTTGAATTTTTTAAAATTCGTGTACTTTTTTGTGTGATGTTGAGAATGATTTGGAGACTTGTTTCTTTTTTGTTGGTTTTTATCAAAATGGCTATCTT
CTCATTTTCTAGTATGTAATTCACAGTGCATTAGAAACATTGTTGTGATAAGAGTTATGTGATAAGAGGATGTACCATTTCGAGGGTCGTATCGCTTGCC
ACGATGGAGATTATAATTCGAGGGATGTATCGCGCGCCGCAACAGTTACTACTGTCGAGGTTCGTGTCGTGACCCGCAACAGATGCATGGACAAATATGT
CCCCCATGGGTCCCAGACTGAGAGATAGCGGGTATGTATCGTTAGGGAAGACATGCATCACTATCCTTGACATTGCATCTCATGGCATTACACATTTTTA
TTATTTATGAACTTGAATACGTGGTTTGCTGATCTTGTTAGTGTTTACCCCCCAAAATTGTGACTGTTGAATATTGAGATGTTATTGAGAATATGTAAAC
TAATAGAGTGTGGTTAATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955573
Expected error %
0.674996
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0173M12
Clone
Clone name
hba-173m12
LE_HBa0173M12
P173M12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found