Clone Read LE_HBa0173M22_SP6_105450

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0173M22_SP6_105450
Primer
SP6
ID from Seq. Facility
LE_HBa_173_M22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
720 trimmed for vector and quality, 817 raw
Sequence
>LE_HBa0173M22_SP6_105450 (raw untrimmed)
TGGGGACCCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTCCTTTTAAAACACTGGTGCGCTCCCATCTAATAGAGCTAAAGCCCAAGAC
CCATTTAATTTATGTAATTCACTGCAATGACAAGTGAAAACTGCGCAGATAAGCTTAACGAGCAAAAGGGGAAGAAACAATGACAGTTCTCCATTTTTGT
TTGAAAGGACGAAAGGATATTGTTCCTGCTGACTTGCAATTGGAAGTTGAGTAATAGTGATCAAGAAGAACTAAAATGTGTGTGCTCATGTCATGATGAA
AGAAATAATTGTCTTAAAAAACATAAATGCGACAGAGATTGCATAACCGAAGACCCTGACAAAATGAACAAGATCCTACATGCCTCAAGCAGTACAGCAA
CTGATAGTATATTTTTCCAGACAGCAAACTAGAAACATAGCGAACAATGCACTTCACAAATCTAAGGACCTCGGAAACTGTCTGCTTTGTCCAGTCTTGA
GATACCTGAGCTTGAGGACTCTCCCATTACATCAGGAGAAGATGTTGGATGGTGTTCGCGCTTCAAAGAAGTAGGCAGTCCTGAAACTTCCTGAAAGAAA
ATTAGAAGGAGTAACATTTCTTTAGGCTAAATTTACACAATTTCATGATTAGGATAGAGAATGTCATGTTGCAATGTTTGCCCTCGATAAGAATTCAGAT
GACTGAATTTCCACTTCACATTCAATAGCAAGCAATTATTTATACCCATTATCTGAAGGAATCCAAAATTTGAAAAAATCAACAACCCTGGCCCAAATCA
AAACCCAGTGGCCACCG
>LE_HBa0173M22_SP6_105450 (trimmed for quality and cloning vector)
AGCTTACTCCTTTTAAAACACTGGTGCGCTCCCATCTAATAGAGCTAAAGCCCAAGACCCATTTAATTTATGTAATTCACTGCAATGACAAGTGAAAACT
GCGCAGATAAGCTTAACGAGCAAAAGGGGAAGAAACAATGACAGTTCTCCATTTTTGTTTGAAAGGACGAAAGGATATTGTTCCTGCTGACTTGCAATTG
GAAGTTGAGTAATAGTGATCAAGAAGAACTAAAATGTGTGTGCTCATGTCATGATGAAAGAAATAATTGTCTTAAAAAACATAAATGCGACAGAGATTGC
ATAACCGAAGACCCTGACAAAATGAACAAGATCCTACATGCCTCAAGCAGTACAGCAACTGATAGTATATTTTTCCAGACAGCAAACTAGAAACATAGCG
AACAATGCACTTCACAAATCTAAGGACCTCGGAAACTGTCTGCTTTGTCCAGTCTTGAGATACCTGAGCTTGAGGACTCTCCCATTACATCAGGAGAAGA
TGTTGGATGGTGTTCGCGCTTCAAAGAAGTAGGCAGTCCTGAAACTTCCTGAAAGAAAATTAGAAGGAGTAACATTTCTTTAGGCTAAATTTACACAATT
TCATGATTAGGATAGAGAATGTCATGTTGCAATGTTTGCCCTCGATAAGAATTCAGATGACTGAATTTCCACTTCACATTCAATAGCAAGCAATTATTTA
TACCCATTATCTGAAGGAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.952648
Expected error %
0.765857
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0173M22
Clone
Clone name
hba-173m22
LE_HBa0173M22
P173M22
Clone type
BAC
Contamination
none
Estimated length
41,806
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found