Clone Read LE_HBa0182B24_SP6_105694

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0182B24_SP6_105694
Primer
SP6
ID from Seq. Facility
LE_HBa_182_B24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
529 trimmed for vector and quality, 696 raw
Sequence
>LE_HBa0182B24_SP6_105694 (raw untrimmed)
AAGCTTCTTTGTTTGCTGATGCGGTTCTTATATTAATGAGCTCAAAGCCAAAGTGGAAGAACTCAAGGCTCCCCCTTAGGTGTCAACTAAAAAATTAATT
CAGAAGAGAAACTGCCTTTCATCATCTGCAGTAGTTGATGGTACGAATATTAATATTAATATTAATTCATCGTTCGTGGACGGAATGGAGGTGGAGGTGA
AAATTATTGGAGTTGAAGCTATGATTCGGGTGCGTTCACCGAATGTGAACTATCCATGTGCGAGATTGATGAACGTTTTACGAGAGTTAGAGTTTCAGAT
TCACCATGCAACCGTTTCAAGTATGAAGGAGATGATGCAACAAGATGTTGTCATTAGGGTTCCTCATAATGTCACTAATGAAGAAGCCATCAAATCTGTT
ATCCTCACAAAGTTAAGTTTTGCTTAGCTTACATTTCATTTGATATATAAATATTACTCGTATACTATAATTTCATTGTCATATCAAGTGTTTCTAATAT
ATATGAAGGACACACACACATATATATATATATATATCGTACGTCTTCTTATTGATCAGGTGAATGCTGTATCATATATAATCTACTACTTTTTAAGTTT
AAAGCTACTTAATTTGTTTTTTTTCCTTTTCAATGTTTATTTTAGACCAAACTTCTCTAATTAGTTTATTTTTAGACTTCTCGAAGCCAGTTGAAA
>LE_HBa0182B24_SP6_105694 (trimmed for quality and cloning vector)
CTTATATTAATGAGCTCAAAGCCAAAGTGGAAGAACTCAAGGCTCCCCCTTAGGTGTCAACTAAAAAATTAATTCAGAAGAGAAACTGCCTTTCATCATC
TGCAGTAGTTGATGGTACGAATATTAATATTAATATTAATTCATCGTTCGTGGACGGAATGGAGGTGGAGGTGAAAATTATTGGAGTTGAAGCTATGATT
CGGGTGCGTTCACCGAATGTGAACTATCCATGTGCGAGATTGATGAACGTTTTACGAGAGTTAGAGTTTCAGATTCACCATGCAACCGTTTCAAGTATGA
AGGAGATGATGCAACAAGATGTTGTCATTAGGGTTCCTCATAATGTCACTAATGAAGAAGCCATCAAATCTGTTATCCTCACAAAGTTAAGTTTTGCTTA
GCTTACATTTCATTTGATATATAAATATTACTCGTATACTATAATTTCATTGTCATATCAAGTGTTTCTAATATATATGAAGGACACACACACATATATA
TATATATATATCGTACGTCTTCTTATTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952851
Expected error %
0.640377
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g00870.1 Score 84 E Value 6e-17 Identity 11.00% Align. Length 389bp (73.53%) Frame 1
68417.m00118 basic helix-loop-helix (bHLH) family protein similar to the myc family of helix-loop-helix transcription factors; contains Pfam profile PF00010: Helix-loop-helix DNA-binding domain; PMID: 12679534
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g32640.1 Score 81 E Value 3e-16 Identity 11.40% Align. Length 386bp (72.97%) Frame 1
68414.m04026 basic helix-loop-helix (bHLH) protein (RAP-1) identical to bHLH protein GB:CAA67885 GI:1465368 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80896.1| Score 84 E Value 2e-15 Identity 11.00% Align. Length 389bp (73.53%) Frame 1
AT4g00870 [Arabidopsis thaliana] ref|NP_567195.1| basic helix-loop-helix (bHLH) family protein [Arabidopsis thaliana] emb|CAD58596.1| putative bHLH transcription factor [Arabidopsis thaliana] gb|AAB62853.1| similar to the myc family of helix-loop-helix transcription factors [Arabidopsis thaliana] pir||T01559 hypothetical protein A_TM018A10.7 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA67885.1| Score 81 E Value 1e-14 Identity 11.40% Align. Length 386bp (72.97%) Frame 1
bHLH protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0182B24
Clone
Clone name
hba-182b24
LE_HBa0182B24
C08HBa0182B24
P182B24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found