Clone Read LE_HBa0182E22_SP6_105834

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0182E22_SP6_105834
Primer
SP6
ID from Seq. Facility
LE_HBa_182_E22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
618 trimmed for vector and quality, 772 raw
Sequence
>LE_HBa0182E22_SP6_105834 (raw untrimmed)
GTTGGAGATGATTTTGATGCGTTTACTTCTGCTAAGTCTTCTGATTTGGCTCAGCCACTTGTTGAGGCCCCCTTTCCGTACAAAATTCATATTGTGAAGG
ATCATGATATGCCCTTAAGGCTATGTCTTGAGGTTGAGAGGCTAGGATTGAGTGCAGTTATCATGGGTAGTCGAGGATTCGGGGCTACTAAGAGAGGAAA
TGATGGGAGGCTTGGAAGTGTTAGTGATTACTGTGTTAGGCATTGTGTTTGCCCTGTTGTGGTTGTGAGGTATCCTGATGAGAAGGATGGTGGAAATGCT
GCTCGTAAGGGCGGAGTTCCTGTGGCATCTGCCTCAAAAGAAAACGAGGAGGAAGGCGAGTACCATGATGCTTGTGATGGTCGTCAAGGTATGTGCAAAA
TTCATCCTAATGTTTGCTTAGTTATTTTCGGGTCTTTATATGTAAATTTATGCAATTTGCTGCTGGTTATCAGTTTGTTCCATTTTCTAATTGAAATGAA
AGACCCTTTCATGTTTTATAATGTAAAATGTGGCACACTGCTGTCAACTCTGTGATTTGGCTGTGTGTTATACCAAAAGGAAAATTAGGTGGGTACTCCC
CAAAATAGTCACATTCAAGAAAGGTAATGCCTGTTACAGTTTATGCATATGATTTTGACATGCAATAGAGTGCAAGAAATCCGTGATACTTTGTAACCAT
TATGATATGTTTGGGCACCAATATCGTTTAGAGTATATAGCTTTTAAAAGTTTCCAAAATTTGAGTGCGATT
>LE_HBa0182E22_SP6_105834 (trimmed for quality and cloning vector)
TGATGCGTTTACTTCTGCTAAGTCTTCTGATTTGGCTCAGCCACTTGTTGAGGCCCCCTTTCCGTACAAAATTCATATTGTGAAGGATCATGATATGCCC
TTAAGGCTATGTCTTGAGGTTGAGAGGCTAGGATTGAGTGCAGTTATCATGGGTAGTCGAGGATTCGGGGCTACTAAGAGAGGAAATGATGGGAGGCTTG
GAAGTGTTAGTGATTACTGTGTTAGGCATTGTGTTTGCCCTGTTGTGGTTGTGAGGTATCCTGATGAGAAGGATGGTGGAAATGCTGCTCGTAAGGGCGG
AGTTCCTGTGGCATCTGCCTCAAAAGAAAACGAGGAGGAAGGCGAGTACCATGATGCTTGTGATGGTCGTCAAGGTATGTGCAAAATTCATCCTAATGTT
TGCTTAGTTATTTTCGGGTCTTTATATGTAAATTTATGCAATTTGCTGCTGGTTATCAGTTTGTTCCATTTTCTAATTGAAATGAAAGACCCTTTCATGT
TTTATAATGTAAAATGTGGCACACTGCTGTCAACTCTGTGATTTGGCTGTGTGTTATACCAAAAGGAAAATTAGGTGGGTACTCCCCAAAATAGTCACAT
TCAAGAAAGGTAATGCCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964603
Expected error %
0.184666
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g27320.1 Score 123 E Value 7e-29 Identity 19.60% Align. Length 356bp (57.61%) Frame 3
68417.m03920 universal stress protein (USP) family protein low similarity to ER6 protein [Lycopersicon esculentum] GI:5669654, early nodulin ENOD18 [Vicia faba] GI:11602747; contains Pfam profile PF00582: universal stress protein family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g11360.2 Score 123 E Value 9e-29 Identity 19.80% Align. Length 362bp (58.58%) Frame 3
68414.m01305 universal stress protein (USP) family protein contains Pfam PF00582: universal stress protein family domain; similar to ethylene-responsive ER6 protein (GI:5669654) [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD43031.1| Score 124 E Value 2e-27 Identity 19.60% Align. Length 356bp (57.61%) Frame 3
unknown protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79587.1| Score 123 E Value 3e-27 Identity 19.60% Align. Length 356bp (57.61%) Frame 3
putative protein [Arabidopsis thaliana] emb|CAA19726.1| putative protein [Arabidopsis thaliana] pir||T05756 hypothetical protein M4I22.130 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0182E22
Clone
Clone name
hba-182e22
LE_HBa0182E22
P182E22
Clone type
BAC
Contamination
none
Estimated length
365,930
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found