Clone Read LE_HBa0182H10_SP6_105954

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0182H10_SP6_105954
Primer
SP6
ID from Seq. Facility
LE_HBa_182_H10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
623 trimmed for vector and quality, 773 raw
Sequence
>LE_HBa0182H10_SP6_105954 (raw untrimmed)
ATTTACGATTAATTTGTTTCCAGAAGAAAATGAATGTGTACCATTGTAAGTAGTGTGACCTTCACTGTTCCCTTTATTTTGTGTCCTGCCTCCTCTACTA
CCATTATTTCCAAACTCATTTCTTTTCTTGTGTTTCCAGTCACTAAGATAACCATTTAACTTGTAGCAGTTTTCTCTTGTATGACCAATAAAGTGACAAT
AATCACATTATACCTTCCTTTCTCTAAATGATTGATTACCCTGGTTATAGATCTGATTTTGACTGGATTGCATAGCCATAGGAGCAAAGTTCTTAGTTGC
AGTCATTAAACAAGCAGAATATTGAACTTCATCCTCAATCACCATAGCATAGGCTTGATTGATAGATGTAGTGACACTTTTCAATAAGATCTGTCTTCGA
GCTTGATTGTAAGAGTCATTTAAGCCACTCAAAAATTGTATCAACCTCAACTGATATAGATGATCAATGTAATCCTTGGATCTAACACACTCACAGCTTG
GTGAAGACACTACTGCATCATACACATTCCAGAGATTTTTCAACTTGCTAAAATAATTCGAGACAGAATCAGTACCTTGGGCAAGAGTAATGATTTCTCG
GTGCAATTGATAGATTTTGACTCGATTAACCTTATCGAAATGTTCCTTTCAAATCTACTCCGACCTTGTGAGCACTTATAGCTTACACAATCCCTCCTAA
GGGACCTCTTCACCCACTGTATTCATCAGCCACAAAAGAACAATTGCATAACAAGTCTCCCAACTGCTCCTGC
>LE_HBa0182H10_SP6_105954 (trimmed for quality and cloning vector)
AATGTGTACCATTGTAAGTAGTGTGACCTTCACTGTTCCCTTTATTTTGTGTCCTGCCTCCTCTACTACCATTATTTCCAAACTCATTTCTTTTCTTGTG
TTTCCAGTCACTAAGATAACCATTTAACTTGTAGCAGTTTTCTCTTGTATGACCAATAAAGTGACAATAATCACATTATACCTTCCTTTCTCTAAATGAT
TGATTACCCTGGTTATAGATCTGATTTTGACTGGATTGCATAGCCATAGGAGCAAAGTTCTTAGTTGCAGTCATTAAACAAGCAGAATATTGAACTTCAT
CCTCAATCACCATAGCATAGGCTTGATTGATAGATGTAGTGACACTTTTCAATAAGATCTGTCTTCGAGCTTGATTGTAAGAGTCATTTAAGCCACTCAA
AAATTGTATCAACCTCAACTGATATAGATGATCAATGTAATCCTTGGATCTAACACACTCACAGCTTGGTGAAGACACTACTGCATCATACACATTCCAG
AGATTTTTCAACTTGCTAAAATAATTCGAGACAGAATCAGTACCTTGGGCAAGAGTAATGATTTCTCGGTGCAATTGATAGATTTTGACTCGATTAACCT
TATCGAAATGTTCCTTTCAAATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.955859
Expected error %
0.353833
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 149 E Value 5e-35 Identity 15.00% Align. Length 599bp (96.15%) Frame 3
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU93584.1| Score 125 E Value 6e-28 Identity 13.00% Align. Length 524bp (84.11%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0182H10
Clone
Clone name
hba-182h10
LE_HBa0182H10
C08HBa0182H10
P182H10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found