Clone Read LE_HBa0182M21_SP6_106216

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0182M21_SP6_106216
Primer
SP6
ID from Seq. Facility
LE_HBa_182_M21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
696 trimmed for vector and quality, 784 raw
Sequence
>LE_HBa0182M21_SP6_106216 (raw untrimmed)
TTTTAACTTTGTCTTGTGAGTATGAAATGACTTGTCTCAGCTACAGCTGTAGTTTTCCATCCCTTAAATACCTCATTGTTAAATCATTGCACTACACTGT
CTCCAGATGCAGCAATAAAAAAGATGCTCGCCACTCTGAATGACCCTTTCACCCGTTTTCTGGAGCCTGAAAAGTTCAAAAGTTTGCGGGTATGGTTCTT
GTTTTCTCTTGTCTTATTAGCTGGTGAGTTAACTCCACCACGATTGATTGAAAATTTGCTTCCTAAACAGATCTCTTCATATGTTTTTTGAAGGCAGTCG
GGAACTCAAAATGCACTTACTGGAGTAGGGTTGTCAATTGGCTATCCATTGGGGAAAAATGAATCGGCCTCTGGACTGGTCGTTATCTCAGCTTCTCCAG
GAGGTCCTGCAAATAGGGCTGGCATCTCATCTGGTGATATCATCCTACAAATTGACAATACCAGCACAGAAAACATGGGTATATATGATGCAGCAGAACG
GTTACAGTAAGTTTTCTTCTGGTCCTGACGTGCAGTTTCATTTTATGCTTCACAGTTCAAATTCTTGATGAGATGAAGTCTTATTCTGGGTTTACCAGAC
AAGTGAAGCACAACGACTGAGAGCTTGAACATCAGTAAAATTATTGAATTTACTTGTAACGATTGCCATGCTTTTTTTTTAATAGTATTTTGCCATGATT
TCTTCACTTCCGTTATTTCTTTTTTCAATCTGCTTTGATACACCCTTCCTTTGAGCTGAGGGTCTATGGGGAAGCAACCCTCTC
>LE_HBa0182M21_SP6_106216 (trimmed for quality and cloning vector)
ATGACTTGTCTCAGCTACAGCTGTAGTTTTCCATCCCTTAAATACCTCATTGTTAAATCATTGCACTACACTGTCTCCAGATGCAGCAATAAAAAAGATG
CTCGCCACTCTGAATGACCCTTTCACCCGTTTTCTGGAGCCTGAAAAGTTCAAAAGTTTGCGGGTATGGTTCTTGTTTTCTCTTGTCTTATTAGCTGGTG
AGTTAACTCCACCACGATTGATTGAAAATTTGCTTCCTAAACAGATCTCTTCATATGTTTTTTGAAGGCAGTCGGGAACTCAAAATGCACTTACTGGAGT
AGGGTTGTCAATTGGCTATCCATTGGGGAAAAATGAATCGGCCTCTGGACTGGTCGTTATCTCAGCTTCTCCAGGAGGTCCTGCAAATAGGGCTGGCATC
TCATCTGGTGATATCATCCTACAAATTGACAATACCAGCACAGAAAACATGGGTATATATGATGCAGCAGAACGGTTACAGTAAGTTTTCTTCTGGTCCT
GACGTGCAGTTTCATTTTATGCTTCACAGTTCAAATTCTTGATGAGATGAAGTCTTATTCTGGGTTTACCAGACAAGTGAAGCACAACGACTGAGAGCTT
GAACATCAGTAAAATTATTGAATTTACTTGTAACGATTGCCATGCTTTTTTTTTAATAGTATTTTGCCATGATTTCTTCACTTCCGTTATTTCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968828
Expected error %
0.214564
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g17740.1 Score 123 E Value 8e-29 Identity 17.90% Align. Length 395bp (56.75%) Frame 3
68417.m02648 C-terminal processing protease, putative similar to C-terminal protease precursor [Spinacia oleracea] GI:999435; similar to SP|Q44879| (Bartonella bacilliformis)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g17740.2 Score 123 E Value 8e-29 Identity 17.90% Align. Length 395bp (56.75%) Frame 3
68417.m02649 C-terminal processing protease, putative similar to C-terminal protease precursor [Spinacia oleracea] GI:999435; similar to SP|Q44879| (Bartonella bacilliformis)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL99046.1| Score 158 E Value 1e-37 Identity 22.10% Align. Length 398bp (57.18%) Frame 3
D1 protease precursor [Nicotiana plumbaginifolia]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL99043.1| Score 128 E Value 1e-28 Identity 18.50% Align. Length 398bp (57.18%) Frame 3
D1 protease precursor [Triticum aestivum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0182M21
Clone
Clone name
hba-182m21
LE_HBa0182M21
C12HBa0182M21
P182M21
Clone type
BAC
Contamination
none
Estimated length
76,917
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found