Clone Read LE_HBa0182M21_T7_106217

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0182M21_T7_106217
Primer
T7
ID from Seq. Facility
LE_HBa_182_M21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
470 trimmed for vector and quality, 823 raw
Sequence
>LE_HBa0182M21_T7_106217 (raw untrimmed)
CGCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCAACCAAGTTGCTCGCAGAACCCTTCAATCTACCGTGAAATACAGAAGTGC
ATGGGAATCATCAGAAACCAAATTCTGTCATTGGTACCAACGTAGACCATGTGTAAGTTGCACGGACTCTTCACTTTCGATGCCGTACCCGTATCGGATT
CTCTAAAAAAGTACACTACATTTGGAGAACCTGCCACACACCCGTTGACATTTTTGAAAGTCCGAGCAACATGTTTATCAACTCTAGTCTTTTTACATCT
TGTAAACTCAGTATGCAGATAATAACCTTATTCATCGTTCAGCTCTTAGACCAATTCAAAACTTAATTAACTGCCTCAATGGTGATTTCTGTTTTTCTGT
TCCCCTCCTAATGGAGAGTGGTATTGTTGAAAATCAGTATCTGCTACTACCTGTTGGATTGCAAGTTAAAAGAGGCATGAAATGATGAATTTTGTTTCTT
GGACTATTCCTATGACATGAGCTTCTTACTTGTTTGTGGAGTCGTAAAGTTAGAGTCTTTTCATAAATCACCTCTATCCTTCTACAATGTATTGGTAATC
GTCTTGCTCACACCCCTCCCTCCCCTCGACCCCCATTGACTGCTGTTGTTCCACGATATTCGACCCATATTACTTACTTCTAACAACAGTGTATTAGTTT
TTTGATGTTTTATGCCTATATCTGATATTTTTCTGCTATAATTACCTCGATGGTGGAAAACATCCTCTCCGACAAAAATATTAAAGGAAGGTCTGCGTGC
AATGATATTAATATATATGTTTA
>LE_HBa0182M21_T7_106217 (trimmed for quality and cloning vector)
AGCTTGCAACCAAGTTGCTCGCAGAACCCTTCAATCTACCGTGAAATACAGAAGTGCATGGGAATCATCAGAAACCAAATTCTGTCATTGGTACCAACGT
AGACCATGTGTAAGTTGCACGGACTCTTCACTTTCGATGCCGTACCCGTATCGGATTCTCTAAAAAAGTACACTACATTTGGAGAACCTGCCACACACCC
GTTGACATTTTTGAAAGTCCGAGCAACATGTTTATCAACTCTAGTCTTTTTACATCTTGTAAACTCAGTATGCAGATAATAACCTTATTCATCGTTCAGC
TCTTAGACCAATTCAAAACTTAATTAACTGCCTCAATGGTGATTTCTGTTTTTCTGTTCCCCTCCTAATGGAGAGTGGTATTGTTGAAAATCAGTATCTG
CTACTACCTGTTGGATTGCAAGTTAAAAGAGGCATGAAATGATGAATTTTGTTTCTTGGACTATTCCTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.965519
Expected error %
0.449623
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0182M21
Clone
Clone name
hba-182m21
LE_HBa0182M21
C12HBa0182M21
P182M21
Clone type
BAC
Contamination
none
Estimated length
76,917
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found