Clone Read LE_HBa0182P12_SP6_106342

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0182P12_SP6_106342
Primer
SP6
ID from Seq. Facility
LE_HBa_182_P12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
663 trimmed for vector and quality, 744 raw
Sequence
>LE_HBa0182P12_SP6_106342 (raw untrimmed)
GATTTTAACTGAGAAGATGAATTGGCGGCCATTTGGCCTTGTAAATTGTGGTAACAGGTATGTGGCATGACCTTTAGGGAGTTTTGGATGAATTGTGCCT
CGTATAACTTCCTCTTTACATGTTTGAATTTTTTTCGTAACATTCTGATTTCAAGTAAGTATATCACTTTATTGAAGTCTCTGAACATGCATTCCCTTTT
TAGGAGTAAAAGTTTCTCAGCCATTGGTTGTTCAGTCTACCAAGAAATTTGGTTGATTACTGTGAGGTTCAAATTATATGAGAAACACTTTGCATGATTC
ATGATGATTGACAGAGTGACGTTCAAGAGCCTTTTTCTGCTGAGATCATTATTGCATAAATTTATGAAGTAAAGTGGACTCCTGTACTCAAAAGTTGTGA
AAAGATATTATATCACCGTGGGGGAGTTTAAAATGAGTAATGTTAACCATTCCATTATTCACACAAATCCTTCAATGACTTATTGGCTGCCTTGTTTGAG
GAATAGTTTCACATCTGTTGATTTCAATATAAGTTTACTATTCATTTCATACGAAGGATGTTGTGGGCCAAAATATACCTGGAATTTATGATGTTTTATG
CCCTCCTTAAACACAAAGATTGACTGGTTTCAACGAAAATAACATTGTGAATAGACAAAGGAATCAGATATCAATTTGACTACTTTAAGAGGCTTTAGTC
AAGATTTAATGGCCGAATATTCCGATTTCCTGCTGTCCAATTTC
>LE_HBa0182P12_SP6_106342 (trimmed for quality and cloning vector)
GGCCATTTGGCCTTGTAAATTGTGGTAACAGGTATGTGGCATGACCTTTAGGGAGTTTTGGATGAATTGTGCCTCGTATAACTTCCTCTTTACATGTTTG
AATTTTTTTCGTAACATTCTGATTTCAAGTAAGTATATCACTTTATTGAAGTCTCTGAACATGCATTCCCTTTTTAGGAGTAAAAGTTTCTCAGCCATTG
GTTGTTCAGTCTACCAAGAAATTTGGTTGATTACTGTGAGGTTCAAATTATATGAGAAACACTTTGCATGATTCATGATGATTGACAGAGTGACGTTCAA
GAGCCTTTTTCTGCTGAGATCATTATTGCATAAATTTATGAAGTAAAGTGGACTCCTGTACTCAAAAGTTGTGAAAAGATATTATATCACCGTGGGGGAG
TTTAAAATGAGTAATGTTAACCATTCCATTATTCACACAAATCCTTCAATGACTTATTGGCTGCCTTGTTTGAGGAATAGTTTCACATCTGTTGATTTCA
ATATAAGTTTACTATTCATTTCATACGAAGGATGTTGTGGGCCAAAATATACCTGGAATTTATGATGTTTTATGCCCTCCTTAAACACAAAGATTGACTG
GTTTCAACGAAAATAACATTGTGAATAGACAAAGGAATCAGATATCAATTTGACTACTTTAAG

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945564
Expected error %
0.401325
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g07734.1 Score 70 E Value 1e-12 Identity 18.80% Align. Length 206bp (31.07%) Frame 3
68415.m00983 ribosomal protein S4 (RPS4) identical to small ribosomal protein 4 [Arabidopsis thaliana] GI:1460051
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD83538.1| Score 78 E Value 2e-13 Identity 19.80% Align. Length 206bp (31.07%) Frame 3
ribosomal protein S4 [Nicotiana tabacum] ref|YP_173472.1| ribosomal protein S4 [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD66809.1| Score 72 E Value 9e-12 Identity 23.30% Align. Length 128bp (19.31%) Frame 3
ribosomal protein S4 [Beta vulgaris subsp. vulgaris]
Arabidopsis thaliana Mitochondria (screening/organelle/ATH1_mitochondria)NCBI BLAST
mitochondria Score 155 E Value 5e-39 Identity 92.10% Align. Length 113bp (17.04%) Frame 1
No sequence description found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0182P12
Clone
Clone name
hba-182p12
LE_HBa0182P12
P182P12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found