Clone Read LE_HBa0182P12_T7_106343

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0182P12_T7_106343
Primer
T7
ID from Seq. Facility
LE_HBa_182_P12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
347 trimmed for vector and quality, 888 raw
Sequence
>LE_HBa0182P12_T7_106343 (raw untrimmed)
CTCGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTCGTGTAATGCATCACTTTCTTTTAAATCTCAGCTATGAAACAGGAGAT
CATGTGGGTGTCCCTTTAAAAAATTCTGAAGATACTGTTGAGGAAGCTGCGAGATTGCTGGGGCAGTCATTAGACTTGATATTCTCTTTTCATACCGACA
AGGAGGATGGCACAGCTGGAGGAGGCTCGTTACCCCCACCTTTTCCTGGTCCCTGCACTCTACCTGCTGCACTTGCTTGTTATGCAGATCCTCTGAATCC
ATCGCCGAAGGTGTGTCTCCATCGTAGAATACCCTTTACATCTTTGAACAATCAATGGTGGCCTCGCTTTACTGGAGATACTGATGATGTGTCCTCAGGC
TTCTTTGGTGGTATTTACTGCTCATGTAGCTGAATCTATCGTAATATAGTGGCTCAATTTTCTTGATTTTCTTATTCTTCAACTTCATATTATTCTTTTT
TTTCTTTTTCTTTTTATTTTTTATTTTATTTTTACGTTCTTTATTTTTATTTTAAGATTTAGTAATCATAAAGTCATTAAATGGATTCTCATCATTTAGA
CCATGTAGTTGTCTTAGCTTACGTTGAGACTTCCATTTTCGCACTGGGCTCGAGAATATAATATTGTGAAACCCCCTCCTTCCTACTTCCCCTTGTCGTT
CCTTATTTTAGCTCATCTACCTTCCAGACTACTAATGTTACATACCACCCACTTCTGAAACATGTATGTTTCTTGCACCATCATTCAACTAATTTCCCTT
ACTTACAGCATAAGACTCGTCCATAAGTGGCAATCATTATCTTCAACGTGTATATGTATGTGAATATTTTCGTGGATTGGACAAAGTG
>LE_HBa0182P12_T7_106343 (trimmed for quality and cloning vector)
AGCTTTGTCGTGTAATGCATCACTTTCTTTTAAATCTCAGCTATGAAACAGGAGATCATGTGGGTGTCCCTTTAAAAAATTCTGAAGATACTGTTGAGGA
AGCTGCGAGATTGCTGGGGCAGTCATTAGACTTGATATTCTCTTTTCATACCGACAAGGAGGATGGCACAGCTGGAGGAGGCTCGTTACCCCCACCTTTT
CCTGGTCCCTGCACTCTACCTGCTGCACTTGCTTGTTATGCAGATCCTCTGAATCCATCGCCGAAGGTGTGTCTCCATCGTAGAATACCCTTTACATCTT
TGAACAATCAATGGTGGCCTCGCTTTACTGGAGATACTGATGATGTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973602
Expected error %
2.28772
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g24520.1 Score 80 E Value 1e-16 Identity 17.50% Align. Length 239bp (68.88%) Frame 1
68417.m03515 NADPH-cytochrome p450 reductase, putative / NADPH-ferrihemoprotein reductase, putative similar to NADPH-ferrihemoprotein reductase NADPH-cytochrome P450 oxydoreductase isoform 1 [Populus balsamifera subsp. trichocarpa x Populus deltoides] GI:13183562, SP|P37116 NADPH-cytochrome P450 reductase (EC 1.6.2.4) (CPR) [Vigna radiata] {Phaseolus aureus}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA81211.1| Score 95 E Value 7e-19 Identity 19.20% Align. Length 239bp (68.88%) Frame 1
NADPH-ferrihemoprotein reductase [Vicia sativa] pir||S37159 NADPH-ferrihemoprotein reductase (EC 1.6.2.4) - spring vetch
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC05021.1| Score 89 E Value 3e-17 Identity 18.90% Align. Length 242bp (69.74%) Frame 1
NADPH:ferrihemoprotein oxidoreductase [Papaver somniferum] pir||T10720 NADPH-ferrihemoprotein reductase (EC 1.6.2.4) - opium poppy
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0182P12
Clone
Clone name
hba-182p12
LE_HBa0182P12
P182P12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found