Clone Read LE_HBa0189E17_T7_106593

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0189E17_T7_106593
Primer
T7
ID from Seq. Facility
LE_HBa_189_E17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
305 trimmed for vector and quality, 853 raw
Genbank Accession
Sequence
>LE_HBa0189E17_T7_106593 (raw untrimmed)
GCATCTTTCCTGGGACCCGGGGGGATCCTCTAGAAGTCCTACCTGCAGGCATGCAAGCTTTGATTAGTGGTTCATTAAAGCAAGTGTTGGTATGTCCTCA
CTAGATTCAAGGACATCAGGAATGTTTAGTTTTTCTTATTGAAGGTATTGTAATAGAATTAGATAAACATATATGTTGCAGTATAGGACGTGTCCATAAA
TATTCATATGTCTAAGATAGAGACTTTGAGAATTATCCTTTCTTTATAACTTTCTATAAAAGAGATATTTTGAAGTATTACTAGTTCGTGTGAAAAGTTT
TAATTTTGTACTACTTTTCATACAAGTATGCAATGAATGATGTCAGAGGGCTTGTACAAGACTTCTAAGAGGTCAAGTACATTGTGTTGCGATATGAGGG
AATGCCCTATCCTCTAAGGCGTACTCTCTGGTCGTGGAAAAGTTAGTATCATAGGAATAGGTTATGAACTACTCCATCCGAGTTGAATTCTTCTTAAATC
CACGTCTAGTAGATTCCACTTATTGGTGTGTCCCGACACTTCCATGATCGAGAGGTATAGGATGATTGATATTTACTTTCTTCATCCATCATGTGTCTTT
TCAATAGATTATTGTTATACGTGTACTCCACTCTCTTCCCTTCATTATATATAGGTTTTGTCTCATACATTAATACGCTGTCAAAAAATTTGCAAGAAAC
AGGAACAACAAGTCGAAAAACCACCAGCTAAGATTTGAATCTGCAACCATTAAATTTTCATCGAGATGTTTATTATCCCTCCTCCATTGAGAAATAAATT
CTCTTCTCAGTATTAGACTATAAACTTAAGTATTAATTACATATCTTCCTACA
>LE_HBa0189E17_T7_106593 (trimmed for quality and cloning vector)
GTTGGTATGTCCTCACTAGATTCAAGGACATCAGGAATGTTTAGTTTTTCTTATTGAAGGTATTGTAATAGAATTAGATAAACATATATGTTGCAGTATA
GGACGTGTCCATAAATATTCATATGTCTAAGATAGAGACTTTGAGAATTATCCTTTCTTTATAACTTTCTATAAAAGAGATATTTTGAAGTATTACTAGT
TCGTGTGAAAAGTTTTAATTTTGTACTACTTTTCATACAAGTATGCAATGAATGATGTCAGAGGGCTTGTACAAGACTTCTAAGAGGTCAAGTACATTGT
GTTGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.911885
Expected error %
0.631181
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0189E17
Clone
Clone name
hba-189e17
LE_HBa0189E17
C05HBa0189E17
P189E17
Clone type
BAC
Contamination
none
Estimated length
122,703
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found