Clone Read LE_HBa0189F10_SP6_106626

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0189F10_SP6_106626
Primer
SP6
ID from Seq. Facility
LE_HBa_189_F10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
729 trimmed for vector and quality, 987 raw
Genbank Accession
Sequence
>LE_HBa0189F10_SP6_106626 (raw untrimmed)
CGGATTCCCGCTATTCGTCACTTCAGAACTCTTATCCCTAAGAAGAAAGATGCTGACCAGTTAAGAGATTATAGTCCTCTTAGCTTGATAGGAAGCATCT
ACAAATTATTCTCTGAAGTCTTGACAGGGAGGCTGAAAGGAGTGATCTCCAATCTAGTGGATGTTAAACAAATGGATTTCTTTAAAGGAAGGCATCATGG
ATGCAGATTTAGTGGCAAATGAAATAATAGACTCAAAAGTTCAACAAAGGAAGCTTGATATCCTTTGCAAACTTGATATAGAAAAAACATATGATCATGT
AAACTGGAGTACTTGCTATGTATGCTCAAGAAGTTGGGCTTTGGCAAAAACGGAAATACTGGATCAGATTTTTTATATCCATTGTTAGTTACTCTGTGTT
GATTGATAGATCACATGTTGGCTTTGTTAAGGCTTAGATGGGTCTCGGGCAAGGAGATCCTATCTTTTTACTTGTTAATCATTGCCATGGAAAGTCTAAA
CAATATTTTCAAAACAACTAATTTCTATGGATGGAGAAAGGGTTTTGAGGTAGCTAGGGTAGGGAGTGATAGCCTAGAGGTGACTCATTTACAATATGTT
GATGACACTCTCATATTTTGTGATGCTGATAGAAACCAATCGAGACATCTCAGAATAATCCTACTGCTCTTTGAAGGCATCTCAGGCCTTCACATAAATT
GGGGTAAGAACTTCCTTTACCCCATCAATGATATTCCTTGCATGAAACATGTTGTCATCTATTCCAGGAGGAGCTGTAAGGTCTTTGCCACCCATTTTCT
GGGAATGCCTTGGGGGGGCAGTCAAAGTCTAATGAAATTTGGGATACTGTTAGTGAGAAATGTGAAAAGAATTATAAATATTAAAACCCAATATTCTCAC
AAGGAAGAGCACCGCTTTCTTCTCTCCCTTTTGAAACATTATAACATGCTATGTCCTTTTTCCCCTTACAAAAGGTAGATTAAAAAT
>LE_HBa0189F10_SP6_106626 (trimmed for quality and cloning vector)
ACTCTTATCCCTAAGAAGAAAGATGCTGACCAGTTAAGAGATTATAGTCCTCTTAGCTTGATAGGAAGCATCTACAAATTATTCTCTGAAGTCTTGACAG
GGAGGCTGAAAGGAGTGATCTCCAATCTAGTGGATGTTAAACAAATGGATTTCTTTAAAGGAAGGCATCATGGATGCAGATTTAGTGGCAAATGAAATAA
TAGACTCAAAAGTTCAACAAAGGAAGCTTGATATCCTTTGCAAACTTGATATAGAAAAAACATATGATCATGTAAACTGGAGTACTTGCTATGTATGCTC
AAGAAGTTGGGCTTTGGCAAAAACGGAAATACTGGATCAGATTTTTTATATCCATTGTTAGTTACTCTGTGTTGATTGATAGATCACATGTTGGCTTTGT
TAAGGCTTAGATGGGTCTCGGGCAAGGAGATCCTATCTTTTTACTTGTTAATCATTGCCATGGAAAGTCTAAACAATATTTTCAAAACAACTAATTTCTA
TGGATGGAGAAAGGGTTTTGAGGTAGCTAGGGTAGGGAGTGATAGCCTAGAGGTGACTCATTTACAATATGTTGATGACACTCTCATATTTTGTGATGCT
GATAGAAACCAATCGAGACATCTCAGAATAATCCTACTGCTCTTTGAAGGCATCTCAGGCCTTCACATAAATTGGGGTAAGAACTTCCTTTACCCCATCA
ATGATATTCCTTGCATGAAACATGTTGTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.955436
Expected error %
0.309735
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC33961.1| Score 70 E Value 4e-11 Identity 9.60% Align. Length 686bp (94.10%) Frame 2
contains similarity to reverse trancriptase (Pfam: rvt.hmm, score: 42.57) [Arabidopsis thaliana] pir||T01893 hypothetical protein F8M12.22 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB81184.1| Score 70 E Value 4e-11 Identity 9.60% Align. Length 686bp (94.10%) Frame 2
putative protein [Arabidopsis thaliana] emb|CAB40051.1| putative protein [Arabidopsis thaliana] pir||T04278 hypothetical protein F25I24.40 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0189F10
Clone
Clone name
hba-189f10
LE_HBa0189F10
P189F10
Clone type
BAC
Contamination
none
Estimated length
63,639
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found