Clone Read LE_HBa0189G15_SP6_106684

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0189G15_SP6_106684
Primer
SP6
ID from Seq. Facility
LE_HBa_189_G15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
414 trimmed for vector and quality, 888 raw
Genbank Accession
Sequence
>LE_HBa0189G15_SP6_106684 (raw untrimmed)
TTGGGTAATCCCGCTGAATGGAATTTTCAAGCTAGTACAACTATTAAGCATGGCTGAACAATGACAAGGAAATATGGACAATGAAACCGGTACACTGTCT
CTATCTTATGTAAGCAAATTCAAATGCTCAATTATTGAAGATACACAAGAGTATTGAGTTCAAGTAACATAATTAGCCAGAAGTCAAATATTTGATATAG
GCAAAGATCTGATTTTTCATAAACAGAGCAGCAGTATAACTATTAATTACTTTATGCAGCGATAAAGTAGGAACTAAGCAAGTAACAACACACTCACCCC
CAGCATATCTATAAAAACAAACGGAATAAGAGTGGGGAAGACGTAGTAATTCATAATTCCTCTGTGCACCAACTCTTATTTGACAATATCCATTTAACAT
TATCAAAATAATTTGCAACTGAAAACTATTCTATGATTAAGGTCATGCTTCAAGAATGAACTGCAGAGAGCAGGGCTTAAACGCTACTTATCCAGAAATT
TGATTTCACGCACAAGTGAAAACTTTGATGTTTACGTTTTTCTAAAATAATGTGCTGTCACAATTGGAACAGCTTTAACCTTGCTAGTTACTGCATCTAC
CAACTTTTTGGCAATAGCAACTATTTCATAATTTTTAGTATAATATGTAAAAATCTCTACTATGAGAGCAGAACTTCAAAAGAAAATTATCGGGCCCTGA
CTAGAATGGGTGTGAAGATACGAGCATTCCTTACTGGAAAAGTTTTTCCTACCATTAAAATAACCAATTGCTTTTAGCTTCAACTACTCTAGTTGGTGGA
TTGACTTATTTAACCCGTCGTATTTCGTTTCTTATCCTAATATTACTAATGATTTACGTTTTGGTCCCTTTCGTTGTTTTTCATTGCT
>LE_HBa0189G15_SP6_106684 (trimmed for quality and cloning vector)
AAGCATGGCTGAACAATGACAAGGAAATATGGACAATGAAACCGGTACACTGTCTCTATCTTATGTAAGCAAATTCAAATGCTCAATTATTGAAGATACA
CAAGAGTATTGAGTTCAAGTAACATAATTAGCCAGAAGTCAAATATTTGATATAGGCAAAGATCTGATTTTTCATAAACAGAGCAGCAGTATAACTATTA
ATTACTTTATGCAGCGATAAAGTAGGAACTAAGCAAGTAACAACACACTCACCCCCAGCATATCTATAAAAACAAACGGAATAAGAGTGGGGAAGACGTA
GTAATTCATAATTCCTCTGTGCACCAACTCTTATTTGACAATATCCATTTAACATTATCAAAATAATTTGCAACTGAAAACTATTCTATGATTAAGGTCA
TGCTTCAAGAATGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.938773
Expected error %
0.267125
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0189G15
Clone
Clone name
hba-189g15
LE_HBa0189G15
C02HBa0189G15
P189G15
Clone type
BAC
Contamination
none
Estimated length
123,999
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found