Clone Read LE_HBa0189I08_T7_106767

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0189I08_T7_106767
Primer
T7
ID from Seq. Facility
LE_HBa_189_I08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
612 trimmed for vector and quality, 857 raw
Genbank Accession
Sequence
>LE_HBa0189I08_T7_106767 (raw untrimmed)
CGGGTTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGAACACTTGGATAGAACATCCCAATTTTTCCAAATTGCAGCTAGCCCGTTC
TCAAGGCCTTACCCGTCTTTTGTTTGAACTATACCCATGTAAATCGTATCGTTCAAAAAAGAAAAAGAAGCAAAGACGATTAGAAAGATATTCTTTAGAA
TTCACAAGACGTTTTTATTTTGAAGATATGTTTATATGCTCAAATCACTGCAATGGCCTTGTCTGTCTGTATAGCTCTAAAGACGGTCAAGTTTATTTGT
TCAATGTGAGCACGAGGGAGTTTAAGGCTTTACCTGTGTCTGTGGAAGGGGTGAGGAAGAATTCAATGGATCCTAGATTGTATTTGGGATTTGATAAGGT
AACGGAAAAATACAAGTTGCTCCATATTATTAGGATACCTAATTCCCCAAGAATAATGAAGCATATGATTCTAACTCTAGGAACCAATTCATGGAGATCA
ATCAGTATTCCGATAGATTGTTTTATGGCATATTTACATTGACGGGTTTCTTTACGGCATAGATACTTGTGTCTACTTTGATTTTAGAGAGGAATAATTT
GGGAATCTTCGGACACAAACTAAATTGTCGGTGGTGGAGTCAGTTTGAATGTGATGCACGTTGCATTACTCGGGGAAACTGGCTCTGTGTTGGCCTGAAG
GTGTGTTGAAATGGTCGTTGTTTAATGTCTTCTAGTTGGATCATCGTGAATGTGTGGATTTGGTCTTCCGTGTTGATACCTTTAAACGCGTGGGCGGTTT
TTTGTTTCCATTCCAAGGATTTCATTGGGTCCTTATCAGTTACTTTCTAGTTTTTTT
>LE_HBa0189I08_T7_106767 (trimmed for quality and cloning vector)
AGCTTGGAACACTTGGATAGAACATCCCAATTTTTCCAAATTGCAGCTAGCCCGTTCTCAAGGCCTTACCCGTCTTTTGTTTGAACTATACCCATGTAAA
TCGTATCGTTCAAAAAAGAAAAAGAAGCAAAGACGATTAGAAAGATATTCTTTAGAATTCACAAGACGTTTTTATTTTGAAGATATGTTTATATGCTCAA
ATCACTGCAATGGCCTTGTCTGTCTGTATAGCTCTAAAGACGGTCAAGTTTATTTGTTCAATGTGAGCACGAGGGAGTTTAAGGCTTTACCTGTGTCTGT
GGAAGGGGTGAGGAAGAATTCAATGGATCCTAGATTGTATTTGGGATTTGATAAGGTAACGGAAAAATACAAGTTGCTCCATATTATTAGGATACCTAAT
TCCCCAAGAATAATGAAGCATATGATTCTAACTCTAGGAACCAATTCATGGAGATCAATCAGTATTCCGATAGATTGTTTTATGGCATATTTACATTGAC
GGGTTTCTTTACGGCATAGATACTTGTGTCTACTTTGATTTTAGAGAGGAATAATTTGGGAATCTTCGGACACAAACTAAATTGTCGGTGGTGGAGTCAG
TTTGAATGTGAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.964948
Expected error %
1.01099
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0189I08
Clone
Clone name
hba-189i8
LE_HBa0189I08
P189I08
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found