Clone Read LE_HBa0189M07_SP6_106956

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0189M07_SP6_106956
Primer
SP6
ID from Seq. Facility
LE_HBa_189_M07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
717 trimmed for vector and quality, 962 raw
Sequence
>LE_HBa0189M07_SP6_106956 (raw untrimmed)
TCCCGGGGTTATTGCCTCATTTCGCAATTGAAGGAACTTGTCCTGAAACTAAAAGTGTCTGCATAATAGGCCCTGTTTTCGCAATAGCTTACAATAGTTT
CCCTTCAAATACTTATTTCGGTTGATTAGGAAAAGAAATCAACTGTAAATTTGACTTCCTATAATTTCAAATAGAGGTATTCATTCACTTGTGTAAGACC
ATAAAAAAGACCATGTTACACATGAAACATGTACTACACATTTTACTAAGCTTGAGCTTCAACCTTCTATAACCAAATGAATATTTTATCAAATGAAGAG
CTGTAGATTTGTCATTTGTTCATCGATTTTGTTTTGTTTGATCTGAATATCTATTTGACTTTGCTGAGCTTTAGCACCTTTTCTCCTAGACACAGTTTGA
AAGCCGTCTTCATTTACAGTAGAAACTTTTCTAGTCTGCTTCTTTTTCTGATTTTTAATTCTATCATCTCTTGCCTTAGTCCTGCATTGACTTTCAAAAT
GTCCTTGCATCTTGCAGTATAGACAGTAGCTTGGTACATTGTCATACTCAATATCACGCCATTTTCAATCATCTGCACCATTCAATCTCTTGTATCCTAA
CCAAATTTGGTCCAATCTTGCTTTTAACAACTAATAGTTATCCAAATATTAAAATTGGTATTAATAATTATCAAATAATTGATGAAATTGAGAAAAAGGG
TTTTTTTATCATACAACTCATCAAAATCTAGAAAAAAACTCCAAAAAATTTGCCATAATCATTAGTCTTCTTTTAGTATGATCATTCTCTTAAATCCAGA
ACCTGCTATTATTACCTATATGGTAAAACTGTGGTGGAAAGTTTATTGATTGCCCCTTTCTAATCCAAGTTGCATTTAGATAATACAAGACACAAAAGAA
ATTTAATCTCTCGAAACTTGGGAAATCTTCTTCCCTCTTCAACCCTCAATACATTACTTCTC
>LE_HBa0189M07_SP6_106956 (trimmed for quality and cloning vector)
CTTGTCCTGAAACTAAAAGTGTCTGCATAATAGGCCCTGTTTTCGCAATAGCTTACAATAGTTTCCCTTCAAATACTTATTTCGGTTGATTAGGAAAAGA
AATCAACTGTAAATTTGACTTCCTATAATTTCAAATAGAGGTATTCATTCACTTGTGTAAGACCATAAAAAAGACCATGTTACACATGAAACATGTACTA
CACATTTTACTAAGCTTGAGCTTCAACCTTCTATAACCAAATGAATATTTTATCAAATGAAGAGCTGTAGATTTGTCATTTGTTCATCGATTTTGTTTTG
TTTGATCTGAATATCTATTTGACTTTGCTGAGCTTTAGCACCTTTTCTCCTAGACACAGTTTGAAAGCCGTCTTCATTTACAGTAGAAACTTTTCTAGTC
TGCTTCTTTTTCTGATTTTTAATTCTATCATCTCTTGCCTTAGTCCTGCATTGACTTTCAAAATGTCCTTGCATCTTGCAGTATAGACAGTAGCTTGGTA
CATTGTCATACTCAATATCACGCCATTTTCAATCATCTGCACCATTCAATCTCTTGTATCCTAACCAAATTTGGTCCAATCTTGCTTTTAACAACTAATA
GTTATCCAAATATTAAAATTGGTATTAATAATTATCAAATAATTGATGAAATTGAGAAAAAGGGTTTTTTTATCATACAACTCATCAAAATCTAGAAAAA
AACTCCAAAAAATTTGC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.928785
Expected error %
0.141153
Sequence Annotations 
Automatic Annotations
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 92 E Value 3e-20 Identity 94.80% Align. Length 57bp (7.95%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0189M07
Clone
Clone name
hba-189m7
LE_HBa0189M07
C08HBa0189M07
P189M07
Clone type
BAC
Contamination
none
Estimated length
122,731
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found