Clone Read LE_HBa0189M07_T7_106957

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0189M07_T7_106957
Primer
T7
ID from Seq. Facility
LE_HBa_189_M07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
687 trimmed for vector and quality, 813 raw
Genbank Accession
Sequence
>LE_HBa0189M07_T7_106957 (raw untrimmed)
CTCGGGACCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATATAAGAATGAATTTCTACAATAATATGCACATACTAGGAAAACATGAT
AAATGCAACATTGTTTATAACCCTCATTTAATAGAAACTACTAACCTTAACCTTGTCTAGGAGCAAGGGGAAAAATATGAGGATCATGTCGGCCTCGACC
TTCGATGATGCACCCTTAACAAGATGGATCCTCCATAGAACTTTTACAGAGGAAACCTCTTTATTTCTTAACTAGAGGATCGAAGATCCCAACCGAAACC
TCTTCATCAGAAAGGTACTCATTTACCCCTAAACCTTCTAGATGGAGAATAGACACCGGATCACCTATACATTTCTTGAGCATAAACACATGGAATACCC
GATGGACCGTGGGCCAATTCAATTGGCAATTTTAACTCATATGCCATTTTTTCAACTCGCTTTAAAATTTAATAAGGGCCCACATACTTGGAACTAACTT
TCCCGTTCTTGCTAAACCTCATCACCCCTTTCATGGGTGAACTTTTCAAGTATACCCAATCTCCTATTTCAAATTCAAGGTCTCTTTTTTTATTGTCACC
GTAAGACTTTTGCGGACTATAGGTCGTCTTCAACCTCTCCCATATAAGTCAAACTTTATCCGTGGCCTCATAAACTACCTCAGGACCTAGAAAAGAAAAC
TCAACCACTTCAAACCATCCAACTGGAGGCCGTCCCATTGTTTTCAAGAAGTGCTTCGAATGGTGCCATGACAATACTCGAATGGTATCCTATGGTGTAA
GGAAAATTCTATC
>LE_HBa0189M07_T7_106957 (trimmed for quality and cloning vector)
AGCTTAATATAAGAATGAATTTCTACAATAATATGCACATACTAGGAAAACATGATAAATGCAACATTGTTTATAACCCTCATTTAATAGAAACTACTAA
CCTTAACCTTGTCTAGGAGCAAGGGGAAAAATATGAGGATCATGTCGGCCTCGACCTTCGATGATGCACCCTTAACAAGATGGATCCTCCATAGAACTTT
TACAGAGGAAACCTCTTTATTTCTTAACTAGAGGATCGAAGATCCCAACCGAAACCTCTTCATCAGAAAGGTACTCATTTACCCCTAAACCTTCTAGATG
GAGAATAGACACCGGATCACCTATACATTTCTTGAGCATAAACACATGGAATACCCGATGGACCGTGGGCCAATTCAATTGGCAATTTTAACTCATATGC
CATTTTTTCAACTCGCTTTAAAATTTAATAAGGGCCCACATACTTGGAACTAACTTTCCCGTTCTTGCTAAACCTCATCACCCCTTTCATGGGTGAACTT
TTCAAGTATACCCAATCTCCTATTTCAAATTCAAGGTCTCTTTTTTTATTGTCACCGTAAGACTTTTGCGGACTATAGGTCGTCTTCAACCTCTCCCATA
TAAGTCAAACTTTATCCGTGGCCTCATAAACTACCTCAGGACCTAGAAAAGAAAACTCAACCACTTCAAACCATCCAACTGGAGGCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962137
Expected error %
0.291274
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 136 E Value 4e-31 Identity 61.90% Align. Length 541bp (78.75%) Frame 1
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38790.1| Score 136 E Value 4e-31 Identity 61.90% Align. Length 541bp (78.75%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0189M07
Clone
Clone name
hba-189m7
LE_HBa0189M07
C08HBa0189M07
P189M07
Clone type
BAC
Contamination
none
Estimated length
122,731
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found