Clone Read LE_HBa0050G23_SP6_10700

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050G23_SP6_10700
Primer
SP6
ID from Seq. Facility
LE_HBa_050_G23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
514 trimmed for vector and quality, 747 raw
Genbank Accession
Sequence
>LE_HBa0050G23_SP6_10700 (raw untrimmed)
TTCACCTAAACATTTAAAATAGAAAATCATGTAATGATAAACCCCAATACGAACCCACATAGCAGGTTGTAGCCTAGAAGTTAACTACCATGCAACACAA
TGCACAATAACACCATCGTAAACCTCAGTTTTCTTTCCAATCTTCCTTTTTCTACCACAAAAAGAACACCTTCCTGAAGAATGGCTGGGAGGGTCAAAAA
AAAAAAAACTGATTTATTCCAACTGAGTGATAAGTAGGATCTCCATTCAAGCAACCACTTAGCAATTGTTCATTCTAATGTCTAAGGACTCCAGAAAGGT
GTGGTAAACAGAGAAAGCACAAAAGAACAATAAACACCACAGCTTAGAATCTTAACTCCATGCCGTCACAGGGAGTATTTATTTCAAATGTCAGTTGAAT
ACCAAATTCCTCCACACAAATACATAAACCTTAACAACTCTAACCCCTACCGATTGCAGTACATAGTCAGTTTAGGTTTAGTCAACTTGAACTCCAATAA
TACTATAAAAAAAATGACAAATTTCTTTAGTCTATTAAAGAAGTCAGCGCAAAGAGAGAACTTTACCGAGTGGATGCCGCAGGCGCGAAGAGAAGCCATA
GAGGCGGAGGCGGTGGCCCCGACGAAAAAGCGAGGCGACGGCGAAGGCTTAATTTGGCATCTTTCCACCTTTCCCCGGGCAAACCCTCTCCTTTAACCTA
AATTCCCCATAATAACTGAACTTGTACTCCCCGGCTTGCCCCCCATC
>LE_HBa0050G23_SP6_10700 (trimmed for quality and cloning vector)
GAACCCACATAGCAGGTTGTAGCCTAGAAGTTAACTACCATGCAACACAATGCACAATAACACCATCGTAAACCTCAGTTTTCTTTCCAATCTTCCTTTT
TCTACCACAAAAAGAACACCTTCCTGAAGAATGGCTGGGAGGGTCAAAAAAAAAAAAACTGATTTATTCCAACTGAGTGATAAGTAGGATCTCCATTCAA
GCAACCACTTAGCAATTGTTCATTCTAATGTCTAAGGACTCCAGAAAGGTGTGGTAAACAGAGAAAGCACAAAAGAACAATAAACACCACAGCTTAGAAT
CTTAACTCCATGCCGTCACAGGGAGTATTTATTTCAAATGTCAGTTGAATACCAAATTCCTCCACACAAATACATAAACCTTAACAACTCTAACCCCTAC
CGATTGCAGTACATAGTCAGTTTAGGTTTAGTCAACTTGAACTCCAATAATACTATAAAAAAAATGACAAATTTCTTTAGTCTATTAAAGAAGTCAGCGC
AAAGAGAGAACTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940807
Expected error %
0.165513
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050G23
Clone
Clone name
hba-50g23
LE_HBa0050G23
P050G23
Clone type
BAC
Contamination
none
Estimated length
85,390
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found