Clone Read LE_HBa0190C12_T7_107255

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0190C12_T7_107255
Primer
T7
ID from Seq. Facility
LE_HBa_190_C12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
153 trimmed for vector and quality, 871 raw
Sequence
>LE_HBa0190C12_T7_107255 (raw untrimmed)
ATCACTAGCCTCTTTCCGGGGGTTCCTCTATAGTCTACTGCAGGCATGCAAGCTCTATAGGGGGATAGTTGATACCCTTTTGGATCATAAAAGGGGGTTG
AAAAACTAGATATAACATTTTGTCTTTTGGGTGTGCATTGCTGAGGAATATCATGAAGGGATGGGCATATTTCGAGGAAAATATGTCATTGAAGGTCAGA
GATGGAGGAGAGTTTCTCTCTCTCTTTCTGGGGCGCACATGCAAGCTCCCTCGGTGTAATTACTCTATTCGTTCCCTATCTCTCTCACCTCCTTTCTTCA
TTTTTATTTTTTCTTCTTTTTCGCTTCTTTCTTATTATTCTACATTTTCTACCTGTGAGCGTTCATTACTCTCTCCGTTCTTTTCCGGCTTTCCTTTTTC
TTTTTCTTCTCATCTTTCTCTCTCCCTTACTCCTTTTTCGTCTTTGATTTTCTGTTCCTACTTCTTCTTCCTTTTATCTTTCTTTTGTTTTCTTTATTTA
CCTCATCTTCTCCTTACTATCTCTCCTTTCTTTTCTTTGGCTTTCTTCAGTCTTCTCTGTTTTACATTAGTGCTTTCCTATTAATTTGCTATCGCTCTTC
TGCGTGTGCTTTAAATTGCTCATATGGACTCTCTGATTTAACTGCGTTCCTCTTCCTCTGCTTCTTCATACGCCTCTTTATTTTTTTCTTTCGTTTTTTC
TTGTTTTTCCCTCCTATTTCTTTCATCGTTGTCTGTTTTAAAGAGTTCTCAATACAGTTTTTTGCTATTCTTATCTTTATTTCTATTCTTCTCCTGTCTT
TTATCTTTTTTACTACGTCCTCTTTTATCTTTCTTACTCTTTATTTCTTTTTTATCATTTTTTTTTCTTTT
>LE_HBa0190C12_T7_107255 (trimmed for quality and cloning vector)
GGGGATAGTTGATACCCTTTTGGATCATAAAAGGGGGTTGAAAAACTAGATATAACATTTTGTCTTTTGGGTGTGCATTGCTGAGGAATATCATGAAGGG
ATGGGCATATTTCGAGGAAAATATGTCATTGAAGGTCAGAGATGGAGGAGAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.926381
Expected error %
1.4097
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0190C12
Clone
Clone name
hba-190c12
LE_HBa0190C12
P190C12
Clone type
BAC
Contamination
none
Estimated length
106,769
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found