Clone Read LE_HBa0190G10_SP6_107442

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0190G10_SP6_107442
Primer
SP6
ID from Seq. Facility
LE_HBa_190_G10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
609 trimmed for vector and quality, 858 raw
Sequence
>LE_HBa0190G10_SP6_107442 (raw untrimmed)
GTTCTCCCTACTTCTGAGGTCTTCAGTATTTTATTCTTTCTTTCTCATCTATACTAAAGCTAAATATAACCGCTATCCGTATGCCTCGTATAATCAAGAA
ATCTGGAGATGTTCCCAAGGGATATCTTGCTGTGTATGTTGGGGAGGAGCAGAAGAAGAGATTTGTTATCCCCATATCATTCTTGAGCCAACCTTTATTT
CAAGACTTGCTCAGTCAAGCTGAGGATGAATTTGGTTTTGATCATCCAATGGGCGGTCTCACCATACCCTGCAGAGAGGACATCTTCATTGACCTTATTT
CTCATTTGAGAAACTGATGAAAAGACTTTCTTTCACATTTTTGTAGAGCAGCAAAGCAGGATTTGCAGTCTGTACACTTAGGATTTAGAGAAAACAGTAG
TTGATTTTAGAATGACAGTTGTTACTAAAGTCTGACTAGGTAGATTAGTGAACTTATCTCTGTAAAGGCTGATTGTTATTCATGTCATGTCAAAGGGATG
AATAACACTTCATTTTTTTCTACTTAAAAGATATCGAAGTATTGAATCTTTATCACTTTATTGTTCCATTCAGTTTGCGTTGATACTTCTCCTTAAGATT
CCATATGCTCATTTCCTGTGGTTTGCTAATGATTTACGGACCAGAATCAAACTTGTACCACAATCTGTTACACTGTTTTGTTACTTTTAGGATTACTTTC
ACCTGGAATTTTATTCAAAACCTAACTTAGAGCTTATTAAAAACAATTTTCACCCTATCCTTGGTTTCTCCTTTGGCTTTTTTTTTTTATTGTGTAACTA
GCGATTTTTTTTTTTATCATTAGGTTATATTCTATTCATGTTAAGTTATCTCGTTTCT
>LE_HBa0190G10_SP6_107442 (trimmed for quality and cloning vector)
TATTTTATTCTTTCTTTCTCATCTATACTAAAGCTAAATATAACCGCTATCCGTATGCCTCGTATAATCAAGAAATCTGGAGATGTTCCCAAGGGATATC
TTGCTGTGTATGTTGGGGAGGAGCAGAAGAAGAGATTTGTTATCCCCATATCATTCTTGAGCCAACCTTTATTTCAAGACTTGCTCAGTCAAGCTGAGGA
TGAATTTGGTTTTGATCATCCAATGGGCGGTCTCACCATACCCTGCAGAGAGGACATCTTCATTGACCTTATTTCTCATTTGAGAAACTGATGAAAAGAC
TTTCTTTCACATTTTTGTAGAGCAGCAAAGCAGGATTTGCAGTCTGTACACTTAGGATTTAGAGAAAACAGTAGTTGATTTTAGAATGACAGTTGTTACT
AAAGTCTGACTAGGTAGATTAGTGAACTTATCTCTGTAAAGGCTGATTGTTATTCATGTCATGTCAAAGGGATGAATAACACTTCATTTTTTTCTACTTA
AAAGATATCGAAGTATTGAATCTTTATCACTTTATTGTTCCATTCAGTTTGCGTTGATACTTCTCCTTAAGATTCCATATGCTCATTTCCTGTGGTTTGC
TAATGATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952892
Expected error %
0.457892
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g38840.1 Score 115 E Value 2e-26 Identity 24.70% Align. Length 230bp (37.77%) Frame 2
68417.m05499 auxin-responsive protein, putative auxin-inducible SAUR gene, Raphanus sativus,AB000708
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g34810.1 Score 110 E Value 6e-25 Identity 21.40% Align. Length 251bp (41.22%) Frame 2
68417.m04940 auxin-responsive family protein similar to auxin-induced protein X10A5 (SP:P33079) [Glycine max]; small auxin up RNA (SAUR-AC1), Arabidopsis thaliana, PIR2:T06084
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM12778.1| Score 127 E Value 2e-28 Identity 26.30% Align. Length 239bp (39.24%) Frame 2
auxin-induced SAUR-like protein [Capsicum annuum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM12777.1| Score 122 E Value 6e-27 Identity 26.20% Align. Length 224bp (36.78%) Frame 2
putative auxin-induced SAUR-like protein [Capsicum annuum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0190G10
Clone
Clone name
hba-190g10
LE_HBa0190G10
P190G10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found