Clone Read LE_HBa0190G10_T7_107443

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0190G10_T7_107443
Primer
T7
ID from Seq. Facility
LE_HBa_190_G10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
638 trimmed for vector and quality, 860 raw
Sequence
>LE_HBa0190G10_T7_107443 (raw untrimmed)
TCCGGTACCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCAGTCAATGCTTACATGAACTCTTGAAACCAATAATATAACAATGTTATG
GAAATCTACTCAGTGGCAGAGACGCAGAGTCAGAGATTTTTTAAAGGGTGTCCAAAAATATCAACTTGTTATGTTAAGAATGTCAAAATCAGGTTACTTG
TATACATGCTATTCTTTTTCTGATACTGTGAAATAGTAAGACAGATAACATGACATGCATTGAAATGAAATTAGAGAGAACCTGATAGAGCATGAATAGT
GTTAATATTATTCTCCTTGCAGTCAGCACATTCTCCAAAACCAACCACCTTAATTGTGTTGTCATCAGCAATGCAGAAAGTAGAGAGTAGTAAAGACAGG
GACAGTCCCAGAAGGACTCTGCCACAAAGGGACTGAAGCCCCATTCTGTTTATACAAAATAAATGTAAGTTTTGAATGATATTCTTGAATGTGTTCCTCT
CAACTAACTAGAGGGTATATTTATAGTAATTGTTTGCTTACCATAAAGTAAAGAAAAACTTTGTTTTTATGACCGGCTCACCGGCACGTAATTAAGGTCC
TCACATGAGTTTAGGTCCCATGGTCTTGAAATTTTTATGAATGAAAGAAAGATTAAAAAATTGAAAGGTGATCTTCTGTAAATAAAAATAAATAAATAAT
TTGAGGAATTGGGGGGTCACCAAACCTGTTATGATATTTGATTTTTTTTATCTTCTTTTGTGGTTTCTTACCTGTCCTATAAACTGCCCTGTATTTCATT
TTGTTAAATATAAATATGTTATAGTCTTATGTTTGTCAGTTTTATACTTATATGATTTCT
>LE_HBa0190G10_T7_107443 (trimmed for quality and cloning vector)
AGCTTGCAGTCAATGCTTACATGAACTCTTGAAACCAATAATATAACAATGTTATGGAAATCTACTCAGTGGCAGAGACGCAGAGTCAGAGATTTTTTAA
AGGGTGTCCAAAAATATCAACTTGTTATGTTAAGAATGTCAAAATCAGGTTACTTGTATACATGCTATTCTTTTTCTGATACTGTGAAATAGTAAGACAG
ATAACATGACATGCATTGAAATGAAATTAGAGAGAACCTGATAGAGCATGAATAGTGTTAATATTATTCTCCTTGCAGTCAGCACATTCTCCAAAACCAA
CCACCTTAATTGTGTTGTCATCAGCAATGCAGAAAGTAGAGAGTAGTAAAGACAGGGACAGTCCCAGAAGGACTCTGCCACAAAGGGACTGAAGCCCCAT
TCTGTTTATACAAAATAAATGTAAGTTTTGAATGATATTCTTGAATGTGTTCCTCTCAACTAACTAGAGGGTATATTTATAGTAATTGTTTGCTTACCAT
AAAGTAAAGAAAAACTTTGTTTTTATGACCGGCTCACCGGCACGTAATTAAGGTCCTCACATGAGTTTAGGTCCCATGGTCTTGAAATTTTTATGAATGA
AAGAAAGATTAAAAAATTGAAAGGTGATCTTCTGTAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.945723
Expected error %
0.661211
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA04449.1| Score 89 E Value 7e-17 Identity 26.10% Align. Length 164bp (25.71%) Frame 3
proline-rich protein [Solanum tuberosum] pir||T07598 proline-rich protein GPP1 - potato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0190G10
Clone
Clone name
hba-190g10
LE_HBa0190G10
P190G10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found