Clone Read LE_HBa0190G18_T7_107459

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0190G18_T7_107459
Primer
T7
ID from Seq. Facility
LE_HBa_190_G18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
636 trimmed for vector and quality, 845 raw
Sequence
>LE_HBa0190G18_T7_107459 (raw untrimmed)
TGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCGAACTAAGTTCATATAAATTTTTATAAGTACTGGAAACATCAATCATTGT
TGAATAAGCTAATCTCAAGTATAGTTCATGGAACTTCTTGGAGTGTTACATTATCCCCCTAGAGGAACATTGCGATCCACTAATGACACAAAAATCATTT
GGAAGGTAAGGATAGACTTAATACGATAATTCAAACCAAACACAACATCCAATCATAAGGATTCACGGCTTGCAGGAGTACTTAAAACTCCTTTCACATA
CATATCACAACTTTATACATAGCAACTCAATTCATGATGAACGCCTTATAAGAGCTTAACATATCATAACACATAACAAGAAATTTCTTTCTCAACATCA
AAATGATCTTAAAATACATCAAAGACTAACCATTCTATCACCCTTCGCAATAAAACAACAAAACATCAAAATCTCAAGAAGATAACATGTATACGAATTT
CATGTAAGTGCAAGAATAGAGTATGAAGATATTTTTGTAAAACTTCTACTTGGTACGACTTTTTTCCTATACATGCTCCTATTTAGAAAAAATTCAATTT
TAAATTTAATCATTAATTTCTTTATTAACAGAAATTTCTAATCTCCAAGGATTAAATAGATGAAGGAATCGAGACTTTCTGTCCGCTTCGGCTCCTCCAT
GTTGCACCCCTTACCAAGATGGTTCTTCTAAAAAACTTTTTTTTTGAGTGTACCACTTTTTTTCTTCACTTTCTTAATTTTGGTGTTTCTTGGATTTTTT
CTGCTAACCTTAATTCAAAATCTTTGCCTCTATGAATGGTCTTGT
>LE_HBa0190G18_T7_107459 (trimmed for quality and cloning vector)
AGCTTTTCGAACTAAGTTCATATAAATTTTTATAAGTACTGGAAACATCAATCATTGTTGAATAAGCTAATCTCAAGTATAGTTCATGGAACTTCTTGGA
GTGTTACATTATCCCCCTAGAGGAACATTGCGATCCACTAATGACACAAAAATCATTTGGAAGGTAAGGATAGACTTAATACGATAATTCAAACCAAACA
CAACATCCAATCATAAGGATTCACGGCTTGCAGGAGTACTTAAAACTCCTTTCACATACATATCACAACTTTATACATAGCAACTCAATTCATGATGAAC
GCCTTATAAGAGCTTAACATATCATAACACATAACAAGAAATTTCTTTCTCAACATCAAAATGATCTTAAAATACATCAAAGACTAACCATTCTATCACC
CTTCGCAATAAAACAACAAAACATCAAAATCTCAAGAAGATAACATGTATACGAATTTCATGTAAGTGCAAGAATAGAGTATGAAGATATTTTTGTAAAA
CTTCTACTTGGTACGACTTTTTTCCTATACATGCTCCTATTTAGAAAAAATTCAATTTTAAATTTAATCATTAATTTCTTTATTAACAGAAATTTCTAAT
CTCCAAGGATTAAATAGATGAAGGAATCGAGACTTT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.918566
Expected error %
3.93016
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0190G18
Clone
Clone name
hba-190g18
LE_HBa0190G18
P190G18
Clone type
BAC
Contamination
none
Estimated length
95,747
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found