Clone Read LE_HBa0190J03_SP6_107572

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0190J03_SP6_107572
Primer
SP6
ID from Seq. Facility
LE_HBa_190_J03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
700 trimmed for vector and quality, 803 raw
Sequence
>LE_HBa0190J03_SP6_107572 (raw untrimmed)
GTTCTTCCTTACGACTCTTTTTAATTAAATTATTTCTTTTTGGCAATTAAAACACTTTATTACTCACTGTGCATGGATTTGGAGAGAATAACTTGTATCT
TATTCAATAGGTAAACATGTATAAATACAATAATATTAGAAGCTAATTAAGGAAAGAAATAAAGATATATGCTATCTATCTATATCTTTGTGCAATATCA
AGAAAGAGATCTATATACATTCTGTAATGCTCCCCCTCAAGCTAGAGCATGTATATTGATCATGCCCAACTTGTTACAAAGGTAATCTACTCGAGCTCTA
TGCCTTCGTGAACAAATCAGCTACATGTGCTGCTGTCTTCACATAGCCCGCAAATATCAAGTTTTCCTAAATCTTCTTATGAATAAAACGTCAATCAACC
TCAATGTGTTTCATTCTTTCATGATATACCGGACATGCAATATGAAGCGCAACTTCTTATCACACCAAAGTTTTGATGGAGTAGAATGCTTCAGTCCAAT
TTTAGTTAAAAGATGATGTATCTACATGATTTCACATGCAGAATGTCACATTACTCTATATTCAGATTCTGGACTGGACCGACTATGTCACTACATCCCA
TATCCAATTAGGCTTTGAAGCAACTGGACAAAACCAGAAGGAATTTTCTCTGGGAAGGGAACAATAAAAGCCATAAATTCCATTTAGTCAAGTGGGCACT
AGTCTTGTTACCAAAAAAAGTTAGGTGGTCTGGGCATTAGAGACTTAGCACTTTCACACCCAATGCCTACTTATAAAGTGGTGGTGGAGATGCACTCAAA
AGG
>LE_HBa0190J03_SP6_107572 (trimmed for quality and cloning vector)
TTTTGGCAATTAAAACACTTTATTACTCACTGTGCATGGATTTGGAGAGAATAACTTGTATCTTATTCAATAGGTAAACATGTATAAATACAATAATATT
AGAAGCTAATTAAGGAAAGAAATAAAGATATATGCTATCTATCTATATCTTTGTGCAATATCAAGAAAGAGATCTATATACATTCTGTAATGCTCCCCCT
CAAGCTAGAGCATGTATATTGATCATGCCCAACTTGTTACAAAGGTAATCTACTCGAGCTCTATGCCTTCGTGAACAAATCAGCTACATGTGCTGCTGTC
TTCACATAGCCCGCAAATATCAAGTTTTCCTAAATCTTCTTATGAATAAAACGTCAATCAACCTCAATGTGTTTCATTCTTTCATGATATACCGGACATG
CAATATGAAGCGCAACTTCTTATCACACCAAAGTTTTGATGGAGTAGAATGCTTCAGTCCAATTTTAGTTAAAAGATGATGTATCTACATGATTTCACAT
GCAGAATGTCACATTACTCTATATTCAGATTCTGGACTGGACCGACTATGTCACTACATCCCATATCCAATTAGGCTTTGAAGCAACTGGACAAAACCAG
AAGGAATTTTCTCTGGGAAGGGAACAATAAAAGCCATAAATTCCATTTAGTCAAGTGGGCACTAGTCTTGTTACCAAAAAAAGTTAGGTGGTCTGGGCAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959584
Expected error %
0.488163
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO26690.1| Score 76 E Value 9e-13 Identity 13.60% Align. Length 344bp (49.14%) Frame 3
gag-pol polyprotein [Vitis vinifera]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO26684.1| Score 75 E Value 1e-12 Identity 40.70% Align. Length 346bp (49.43%) Frame 1
gag-pol polyprotein [Vitis vinifera]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0190J03
Clone
Clone name
hba-190j3
LE_HBa0190J03
C11HBa0190J03
P190J03
Clone type
BAC
Contamination
none
Estimated length
90,386
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found