Clone Read LE_HBa0192D17_T7_108081

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0192D17_T7_108081
Primer
T7
ID from Seq. Facility
LE_HBa_192_D17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
441 trimmed for vector and quality, 832 raw
Sequence
>LE_HBa0192D17_T7_108081 (raw untrimmed)
GCTGGGTACCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAATAATTAATTTTATGCTGCTTTATGTCAGGTTATAGATGAATTTGGATC
ATTTGACAAGTCTATCTGGAGCTTTGTGAACCACAAGCCTATAGTAAGTGGATTTAGATATCCTCGTCAAGTTCCGGTGAAGACAGCAAAAGCAGATCTG
ATTAGCAAAGACCTAATTAGGAGAGGTTTCCGGGGCGTGGGACCTACTGTGGTCTACTCTTTCATGCAGGTTGCTGGTATTACAAATGACCATCTTATTA
GTTGCTTTAGATTTCCTGACTGTGTTGAATCTGCTGAAGGTAAAGAGAAGGACTCTAACAACGATGAAACTGAATCAGCACAAGCCAACAAAGCAAACGA
AACAGAGATATGTAGATCAATCTATGACTTGAGTTTCTCCTCAGAGTGATTTTCATCTTTGTGTTTTTCAGGTGATATAAAGACTTGTAACAACTTGGTT
AAATTCACATAGATTAGCTGCATAAACTGGTTGTGTACAGAGAAAAATGAGACAATATCTATGCTTATCTTAAAATTCTTTGAGATTTTTGATTTTTAGT
TCAAGATTAACTTATGATTACTTCCCGTCCTCCCCTTTCATATAAAAGAATGGTTGTTTTTAGATTGACCATTTGGATGTTTTATTTGTTTTAGTACCTT
TTTTGTCCTTATTATTCTTTGTTCTATGTTTATACTCATTATTATTTTTGTTTTTGGTGGGGGTAATTTTTGTTTTTTTATAAGCTTTTTTTTTATTTTA
TATATTAATAGATTATTACAGCTTTCTTATTC
>LE_HBa0192D17_T7_108081 (trimmed for quality and cloning vector)
AGCTTAAATAATTAATTTTATGCTGCTTTATGTCAGGTTATAGATGAATTTGGATCATTTGACAAGTCTATCTGGAGCTTTGTGAACCACAAGCCTATAG
TAAGTGGATTTAGATATCCTCGTCAAGTTCCGGTGAAGACAGCAAAAGCAGATCTGATTAGCAAAGACCTAATTAGGAGAGGTTTCCGGGGCGTGGGACC
TACTGTGGTCTACTCTTTCATGCAGGTTGCTGGTATTACAAATGACCATCTTATTAGTTGCTTTAGATTTCCTGACTGTGTTGAATCTGCTGAAGGTAAA
GAGAAGGACTCTAACAACGATGAAACTGAATCAGCACAAGCCAACAAAGCAAACGAAACAGAGATATGTAGATCAATCTATGACTTGAGTTTCTCCTCAG
AGTGATTTTCATCTTTGTGTTTTTCAGGTGATATAAAGACT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962326
Expected error %
1.01314
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g80850.1 Score 136 E Value 4e-33 Identity 23.20% Align. Length 266bp (60.32%) Frame 2
68414.m09485 methyladenine glycosylase family protein similar to SP|P05100 DNA-3-methyladenine glycosylase I (EC 3.2.2.20) (3-methyladenine-DNA glycosylase I, constitutive) {Escherichia coli}; contains Pfam profile PF03352: Methyladenine glycosylase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g57970.1 Score 135 E Value 1e-32 Identity 24.70% Align. Length 254bp (57.60%) Frame 2
68418.m07253 methyladenine glycosylase family protein similar to SP|P05100 DNA-3-methyladenine glycosylase I (EC 3.2.2.20) (3-methyladenine-DNA glycosylase I, constitutive) {Escherichia coli}; contains Pfam profile PF03352: Methyladenine glycosylase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD38103.1| Score 154 E Value 7e-37 Identity 19.90% Align. Length 341bp (77.32%) Frame 2
methyladenine glycosylase protein-like [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD41498.2| Score 152 E Value 4e-36 Identity 20.60% Align. Length 338bp (76.64%) Frame 2
OSJNBa0029H02.18 [Oryza sativa (japonica cultivar-group)] ref|XP_473062.1| OSJNBa0029H02.18 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0192D17
Clone
Clone name
hba-192d17
LE_HBa0192D17
C12HBa0192D17
P192D17
Clone type
BAC
Contamination
none
Estimated length
50,055
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found