Clone Read LE_HBa0192I23_SP6_108332

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0192I23_SP6_108332
Primer
SP6
ID from Seq. Facility
LE_HBa_192_I23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
495 trimmed for vector and quality, 989 raw
Sequence
>LE_HBa0192I23_SP6_108332 (raw untrimmed)
AAAGAGATTTTTTTTTTTGTGGATGATTAAAGTCTACAGTCTTATACTTGGATAATCCCTTCGTAGTGCAATCCACTCACAACTTAGCCACATTTGAGAT
TCATGAAGAGA
TGGCTTACATGAGAACTGAACTTGGGTTGGCATTAATACATATCACTGGGGGTGAAGAAAAGATAAATGCAGTTAACTACTTGTCTAAA
CCACCTCCACCAAATGATGAATGTTATTATGCGGAGGATTCCTATGCAGTAAATGAGCAGATGGGGGGTTTCCGACCGAGTGCCCAAGGCTCAAATCAGG
ATAATTGGCGCCAAGGTCAAGGGAACCAAGGGATAACTATTGTAAAAGAAATGATAGGAATGGGACCTATGTCCCTCCTCAAAATTGTGAAATTACTCCT
AGGGACGGTGGAGATAGTATGGCGCGTGTTAAGGATATGTTGCACGAAATGATGAGGATCGATTTGCAAATGGCCCAATTATTTTTTTTTATGAACACAC
GGCAACCGGGCACTCTTCCTAGCAACACTGTCCAAAATCCGAAAAATGATGCACACTGTATGGCAATCACTACTCAGGGTGGTAAGCAAACCATTGATCC
ACCTATGCCGTCTAATGAGGGAAAAGGTGAGAAAGGAATAAGATAAGGTGGTAGAGAGTATTTAAGAAGTAAAAGATAGCACTGGAAAAAAATGCAAAGT
CCCTATAAAGGTAATTCCCATGCCTAATTCCCCCCTTTCCTCAAAGATTAGTGAAAAAATCAAGGAGGGTAAATTTAGCCGTTTAAAAACATGGTTGAAC
CACTTTCCTATAATGGCCCTTTTGGTAAAATCTCTAAACCAATGCCCACTTTTTAACAGTTTAAAAAGATTGGTGTAAAAAAAAAAATCAATAATGGCAA
GAAAAAAAAAGATACAACNTATAGTTGTATTCCACCGGATCTCCTCTCAAAAAAATAAAAACGGGGCGTCTTCAATACCAGTTAGTAAG
>LE_HBa0192I23_SP6_108332 (trimmed for quality and cloning vector)
TGGCTTACATGAGAACTGAACTTGGGTTGGCATTAATACATATCACTGGGGGTGAAGAAAAGATAAATGCAGTTAACTACTTGTCTAAACCACCTCCACC
AAATGATGAATGTTATTATGCGGAGGATTCCTATGCAGTAAATGAGCAGATGGGGGGTTTCCGACCGAGTGCCCAAGGCTCAAATCAGGATAATTGGCGC
CAAGGTCAAGGGAACCAAGGGATAACTATTGTAAAAGAAATGATAGGAATGGGACCTATGTCCCTCCTCAAAATTGTGAAATTACTCCTAGGGACGGTGG
AGATAGTATGGCGCGTGTTAAGGATATGTTGCACGAAATGATGAGGATCGATTTGCAAATGGCCCAATTATTTTTTTTTATGAACACACGGCAACCGGGC
ACTCTTCCTAGCAACACTGTCCAAAATCCGAAAAATGATGCACACTGTATGGCAATCACTACTCAGGGTGGTAAGCAAACCATTGATCCACCTAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.974341
Expected error %
0.714008
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 111 E Value 9e-24 Identity 22.80% Align. Length 218bp (44.04%) Frame 1
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0192I23
Clone
Clone name
hba-192i23
LE_HBa0192I23
P192I23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found