Clone Read LE_HBa0193H01_SP6_109005

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0193H01_SP6_109005
Primer
SP6
ID from Seq. Facility
LE_HBa_193_H01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
0 trimmed for vector and quality, 871 raw
Sequence
>LE_HBa0193H01_SP6_109005 (raw untrimmed)
TCCCGAGTTATGTGTGCTAGTCAGTCTAATCTATGAGGATCCGCAGGGTACCGAGCTCGAATTCCCCCTATACGTGAGTCCTTTAAGAGTTACACGTGGC
CGTCGTTTTACAACGTGCGTGACCGGGAAAACCCCGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCTAAGA
GGCCCGCACCGATCGCCCTTCCTAACCGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACCCATCTGTGCGGTATTTCACAC
CGCATATGGTGCACTCACATTACTAGCGGCTCAGATGCCGCAGAGTTAAGCCAGCCTCGACAGCCGCCAACTCCCGCTAACGCGAGAGACTAGTGTGGTT
TTTTGTTTTTGATTTTATTTTGGCTCTTTTTCGTTTTATCAGATTGGTGTTTTGTTTGTTTTTTGTATTTGTTTATTTTTGTTTTTTATTTTTATTATTT
GTCGTTCTTTATTTTGAGTGTTTGTTAGATAGTTGTTTGACATTTTATATTTTATGTTGTGGATGTCTCTTACCCTCTGGTGTTTTTCTTTTGATTGTGT
TGTGTTACGTAATGTCTAGGAGTGTTTGATGATTTGCCCCGCCGCCCCCGCTTTGTTTTTCATAAGTCGTGGTTGTGGTGAATGTGGTAGTTGATTTGTA
GAACTTTTTTGTTGGTTTTGTGTTTATTTGTTGTTTTTAGTGGTTGGTTTGTTGCTCTGAGTTGTGGTGATTTTATATTGACTACTACTCGTACTCATTT
ATTGTTTTATACATTTTATGTTATGAAGAAAATATGAGCTTGATAGTATGTTGTTTATCTGTATACGACTT
>LE_HBa0193H01_SP6_109005 (trimmed for quality and cloning vector)

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Low complexity
  • Short cloning insert
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
3' read, short insert
Quality trim threshold
14.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0193H01
Clone
Clone name
hba-193h1
LE_HBa0193H01
C02HBa0193H01
P193H01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found