Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0193M06_T7_109254

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0193M06_T7_109254
Primer
T7
ID from Seq. Facility
LE_HBa_193_M06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
3 trimmed for vector and quality, 807 raw
Sequence
>LE_HBa0193M06_T7_109254 (raw untrimmed)
GTAATATAATTTATTTTTACTGTTGGAAATCCCCTTCCAAAAGGGAGCTGTCCAGTTTCCTAGAAACATATGCTTCATATTGTTTGATTAAGATGTTCGT
GCGGGTCATCTATGGGTGCCCACATGTCTGCATTGATCCATACATGTACAACAGACAATGCGCGGAGAACTGATATGCTTTTACTGTGATATTGGAGCTC
ATGCATTCAGTTCATACAGAACCGATTTGATTTCGTGATATGTCTAAAAAGAGTCTGAGTACCTCTGTAGGAGTGGTAGGGAATATGGGATAGGGAGAGT
GGGGAGAGGAGGGAAAAAAAAAACGAGTTCCTCCACGGTTCCTGGATTCGCCCCTCCTCATAAAAAATACCTAACCATATGTGAAGATGGAAGAAAAAAA
TTATTTATATACCCC
CCCCTCCCGGATTTCGGACTTCTTAAAAAAATAGGGGGGTGCCNGTGGTCCTCCCATGGTAGACGATACGTGCGTGGACGTCCGG
CCCAGCGGATCATCTCACAACCCGAGCGTAGTGTTTAGCATTTGGATTGTTGTTGTCCTTGGACGGGAGGTTGTGGCNTGTGCGCGGTCGCGCACTTGCG
GCCCTCCCCACCTCGTATCCGCACTTGGCATCATATTGTCTACATAACTATAGCTATAAACTGTGAGATAGGTGCACGTGGTTAATTGTTGTATTTTGCG
GGGAAGGGGAAGAATCGAGTGGCTGAGAGTGCACGTGCATTACGCCGTAGTGCGGCGCCTGAGCTTGTGTACAGTTGTATGGCTGTTGTGCTGTGCCTAA
CACCCTG
>LE_HBa0193M06_T7_109254 (trimmed for quality and cloning vector)
CCC

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.765172
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0193M06
Clone
Clone name
hba-193m6
LE_HBa0193M06
C08HBa0193M06
P193M06
Clone type
BAC
Contamination
none
Estimated length
98,667
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found