Clone Read LE_HBa0050L21_SP6_10936

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050L21_SP6_10936
Primer
SP6
ID from Seq. Facility
LE_HBa_050_L21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
706 trimmed for vector and quality, 796 raw
Genbank Accession
Sequence
>LE_HBa0050L21_SP6_10936 (raw untrimmed)
GGCTTCTTCCCCCTTTTTTTAGGATATNGAAGTTTACTCTCTTTTTGTATCTTTTTTCTCATTTTTTTCAATCATTTGATGATTTCAACAAGTCACATCT
TTTGATCTCTCAAGATTTTCTTTTCAACATCCAACTCTTTTCATACCCATTTTAGGGTCCTCGCTCATAATAGCCACCCTCAACTCATGACTTTTCCATT
AGTTGAGGTACACAATACTCGATGTCGGGTCAGGTCCAAAAGAGGTCACTTACTGCATTAGCCACCCTAAACTTAGGCTTTTGGCCTAAATCAGGGTTTA
CATGTTCAAGGAGGGACTGGGGCCAAAACATTAGACCTTGGGAATGTGAGTTGGTGAATAAAAAAATTGATCTATTACAGGATCAACATATTTGGATGAA
AAAGAGATAGTAATTCATTTGGTTAACTTATCCTAGCTTCTAACGCAAATTGCTTTCACAGGACTAACCGGACATGTTCTACCTAGGCTCAAACTTTTTG
AACACTCAAAATCTCCTCACTCACTCTTGGCACATCGTTGCACTATCAGATAATAAGATTTCCTAGTTCAGGTTTTAGTTGAAGGTCATGCAGTCGGTGC
CTATTTATGTCATATTTAGAGCCAACACATTCAATAAATCATAACCTATTATGCAAGCACAACAATGGATGTGATATCCTTTTTATTAGTCATCATGCTT
TTCGTACTTCATTACTTTGTACTTCCTAAGACATGTCAGTTCAACAAAAAATTAAGCAGTCTCTCGGGGAAAAAGAACACATGCAGGAAAAACCCA
>LE_HBa0050L21_SP6_10936 (trimmed for quality and cloning vector)
TCTTTTTGTATCTTTTTTCTCATTTTTTTCAATCATTTGATGATTTCAACAAGTCACATCTTTTGATCTCTCAAGATTTTCTTTTCAACATCCAACTCTT
TTCATACCCATTTTAGGGTCCTCGCTCATAATAGCCACCCTCAACTCATGACTTTTCCATTAGTTGAGGTACACAATACTCGATGTCGGGTCAGGTCCAA
AAGAGGTCACTTACTGCATTAGCCACCCTAAACTTAGGCTTTTGGCCTAAATCAGGGTTTACATGTTCAAGGAGGGACTGGGGCCAAAACATTAGACCTT
GGGAATGTGAGTTGGTGAATAAAAAAATTGATCTATTACAGGATCAACATATTTGGATGAAAAAGAGATAGTAATTCATTTGGTTAACTTATCCTAGCTT
CTAACGCAAATTGCTTTCACAGGACTAACCGGACATGTTCTACCTAGGCTCAAACTTTTTGAACACTCAAAATCTCCTCACTCACTCTTGGCACATCGTT
GCACTATCAGATAATAAGATTTCCTAGTTCAGGTTTTAGTTGAAGGTCATGCAGTCGGTGCCTATTTATGTCATATTTAGAGCCAACACATTCAATAAAT
CATAACCTATTATGCAAGCACAACAATGGATGTGATATCCTTTTTATTAGTCATCATGCTTTTCGTACTTCATTACTTTGTACTTCCTAAGACATGTCAG
TTCAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958846
Expected error %
0.0402173
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050L21
Clone
Clone name
hba-50l21
LE_HBa0050L21
C08HBa0050L21
P050L21
Clone type
BAC
Contamination
none
Estimated length
71,016
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found