Clone Read LE_HBa0194A20_SP6_109470

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0194A20_SP6_109470
Primer
SP6
ID from Seq. Facility
LE_HBa_194_A20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
152 trimmed for vector and quality, 962 raw
Sequence
>LE_HBa0194A20_SP6_109470 (raw untrimmed)
CCCGCGTATTCAACCTCCGGCCAAAACTCAATTTACAATCAACTGAACTCTAGACATTCAACTACCGAGTTAAACCCCTTTGGGGTGCCCATCTTCACCT
TTTCTTCTGCAGGATCCCTTAAAGCCTCCTGATTCTCCAACTGGTCAAAGAGATCAAGGAGAATTACACTATGAGTCTCACTCAACATTTTTCTTCACGC
TACCAAGTCTAGGCTCCTAATTATATCTCGGAGAGATCT
AAACTTCCAGTAAGGTGATTCATTGAAATTTGTGAAAGTCGATTTAGTAGTTGAATCCTTT
TCACAAGCATCAACAAGAGAAACGGAAGAGGCCGAGTCCAACGCCAACAACTTGTCTTCACATTCTACCAAATGGGTCCTCATGTAGGTTTTTCAATTCA
TGATTTCCTGAGATTCATTAGAAAAATGATATTGCTACCCTAATGAGGGGGGGGAGCAAATAAGATTTTTTTTTTTTCCCCCCCCCGGAAGAAGTGAAAA
GGTACTGAAAAAAAAAGGGTCTGAATCGGCAAAGAAAAAAGGAGAAAAAGGAATAAGGCTAAAATAACTGTAAAATTTACGCTTATGAGTTACACGTCCT
ATGGTAGTCCGAAAATCTGTATACCGATGATGTGCTAAAGTTTCACTGTCGGATATTTAAGTGGGCATATAGAAGTTCGCGAGATGTACTGATCGCTAGA
GGCTACCTGTACCCCACTATGTTAATGTATGACGAAACATGGGCCCCGCGTTCTGAACACTGCTACAATATTAGAATGAGCGATAAGACCTCACAGATAC
ATCATAATCAGATTATATAAATTACCATTGCTGTACTATCTAATTATTAATTTACTTGCGTCTCAGCCTGAATACTTTTAGGTTTGATTGGGTGTGATGA
CTTGATAACTATTATATATTGATATGTTTTATTACATTCATTTTTTTTTTATTTTTACTTTT
>LE_HBa0194A20_SP6_109470 (trimmed for quality and cloning vector)
AAACTTCCAGTAAGGTGATTCATTGAAATTTGTGAAAGTCGATTTAGTAGTTGAATCCTTTTCACAAGCATCAACAAGAGAAACGGAAGAGGCCGAGTCC
AACGCCAACAACTTGTCTTCACATTCTACCAAATGGGTCCTCATGTAGGTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.919908
Expected error %
1.01469
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0194A20
Clone
Clone name
hba-194a20
LE_HBa0194A20
C03HBa0194A20
P194A20
Clone type
BAC
Contamination
none
Estimated length
104,969
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found