Clone Read LE_HBa0004G22_SP6_1098

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004G22_SP6_1098
Primer
SP6
ID from Seq. Facility
LE_Hba_004_G22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 1202 raw
Genbank Accession
Sequence
>LE_HBa0004G22_SP6_1098 (raw untrimmed)
CGAATGCTTGGGCACATCAGATTTGTGCATTGTTCAATGGTAGGAGGAATGATGGTGGGCAAGCCGAGTATACCTGTCCCAATTGCTATATTATAGAGGT
TGAAAGAGGTGAGCGTAAGCCCTTACCACAGAGTGCTGTTCTTGGAGCCAAAGATCTGCCTCGCACATGTCTCAGTGATCATATTGAGGTTCGATTAGAT
AGGGTTTTGAAGGATGATAGACAAAAAAGAGCAGAACGTGAAGGAAAAAGTTATGATGAGGTAAGTGAATTGTCTTGCGTTTTGATCACTACAGCCATCA
TGTTAAAGTTTCGTTGTTTAACATAAGAGAATGATACATAAATGGGATATAGTTTTGATTGATAGTCATCATCAAGGCAGTCCCCTCCCCAATACAATAG
ATTCTAAAACAGCTCTATGTCATGCTATGATAAATATTGGCATTCTAAACATCATAAAACTCACACTGGTCTTTATGGTGGATGCTGCATTCACTTCTTT
GACCAGAATAGTTGCTTATGCTCAAGTCCAGACCGTGGAACAGCTTCAGCCTTCTAAAGAAAAGTGACATAAATAATATATCTGCTCTTCCTTTTTCAGA
AAAAAAGAGTAAAATATCTTGTCCTCACATTTTGCAGTTTTATGTTTTCCTTTGGAGAGTTGGATAACCTCATGTAACATTCATTTTAGAGAATATTAAG
AAACTGTGTCAAATATTAGCTTTCATTCATATCCTGGGGTAGGGGATATAAATTTAGCCTTGTGGATTTGCACCCGTCTCAATTGGCTTACCAATTTTCC
CTAATAAATATTAAAAATTTGTTTCCTCTAGAAAAAAAATGTTCTTTGTTTGGGTGGTTTCTTCCAAGTTCCGGTTTAATTGGAAATTTTAGTCAGCCAA
TGGTTCACTTATGGTAGTTTATTTTAACCTTTTGGCTTATTTTTTTTATTTCTCAGGTTCCCGGGGCCTGAAAGGGCTTTGTTGCAAAAATTAGTTTCCC
AATAAACCAAAAAATAAAAATCAAAATTAAGGGTTCTTGAGGTCTTTCTAAAAAAAAACTATCCCCTGGAATTTCCTTAAAAATAAAAAGGTTACCTTTT
TACCTTTTTTTTTAATTTAACAAATAAAATGTGTTTTGGTTTATGAAAACCCAAATAAAAAAAAAAATACTAAGTTATTGGTATTTATTTGAGGAGTAAA
AC
>LE_HBa0004G22_SP6_1098 (trimmed for quality and cloning vector)
ATTTGTGCATTGTTCAATGGTAGGAGGAATGATGGTGGGCAAGCCGAGTATACCTGTCCCAATTGCTATATTATAGAGGTTGAAAGAGGTGAGCGTAAGC
CCTTACCACAGAGTGCTGTTCTTGGAGCCAAAGATCTGCCTCGCACATGTCTCAGTGATCATATTGAGGTTCGATTAGATAGGGTTTTGAAGGATGATAG
ACAAAAAAGAGCAGAACGTGAAGGAAAAAGTTATGATGAGGTAAGTGAATTGTCTTGCGTTTTGATCACTACAGCCATCATGTTAAAGTTTCGTTGTTTA
ACATAAGAGAATGATACATAAATGGGATATAGTTTTGATTGATAGTCATCATCAAGGCAGTCCCCTCCCCAATACAATAGATTCTAAAACAGCTCTATGT
CATGCTATGATAAATATTGGCATTCTAAACATCATAAAACTCACACTGGTCTTTATGGTGGATGCTGCATTCACTTCTTTGACCAGAATAGTTGCTTATG
CTCAAGTCCAGACCGTGGAACAGCTTCAGCCTTCTAAAGAAAAGTGACATAAATAATATATCTGCTCTTCCTTTTTCAGAAAAAAAGAGTAAAATATCTT
GTCCTCACATTTTGCAGTTTTATGTTTTCCTTTGGAGAGTTGGATAACCTCATGTAACATTCATTTTAGAGAATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963022
Expected error %
0.0787342
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g79000.1 Score 132 E Value 2e-31 Identity 23.60% Align. Length 266bp (39.41%) Frame 2
68414.m09212 p300/CBP acetyltransferase-related protein 2 (PCAT2) contains Pfam domains PF02135: TAZ zinc finger and PF00569: Zinc finger, ZZ type; identical to cDNA p300/CBP acetyltransferase-related protein 2 GI:12597460
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g16710.1 Score 129 E Value 1e-30 Identity 22.80% Align. Length 266bp (39.41%) Frame 2
68414.m02003 TAZ zinc finger family protein / zinc finger (ZZ type) family protein contains Pfam profiles PF02135: TAZ zinc finger, PF00569: Zinc finger, ZZ type
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC17068.1| Score 132 E Value 8e-30 Identity 23.60% Align. Length 266bp (39.41%) Frame 2
Similar to CREB-binding protein homolog gb|U88570 from D. melanogaster and contains similarity to callus-associated protein gb|U01961 from Nicotiana tabacum. EST gb|W43427 comes from this gene. [Arabidopsis thaliana] pir||T01055 hypothetical protein YUP8H12R.38 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_565197.2| Score 132 E Value 8e-30 Identity 23.60% Align. Length 266bp (39.41%) Frame 2
p300/CBP acetyltransferase-related protein 2 (PCAT2) [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004G22
Clone
Clone name
hba-4g22
LE_HBa0004G22
P004G22
Clone type
BAC
Contamination
none
Estimated length
128,227
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found