Clone Read LE_HBa0004G22_T7_1099

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004G22_T7_1099
Primer
T7
ID from Seq. Facility
LE_Hba_004_G22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
145 trimmed for vector and quality, 1077 raw
Sequence
>LE_HBa0004G22_T7_1099 (raw untrimmed)
CGGCCCGGTCCCGGGGGGATCCTTCCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTTTAAGTCAACAATATTGCAGATCTTGTAGCCTGGGAACTGCAT
TCCAAGGTAATGAATGCATCAAGATGGAAATGACAACTGGATCACTGTATCACATTCCTGGTAGTTCGTGTAATAGTAAACTTTGGACGTAAATGGATCA
GCAGTCTATATCAATGGAAATTGTAACCACTAGATCTGGTATTACGACAGTCTTTCTTTTATCTTTGTTTCTCCTCTCCGTCTTTTATTTCTTTTCTTTC
TCTGTTTTCTTATCAACTTTGCTTGTCTGTTGTGAGTCCATATCATCCTTTATAGTGTATATATTGTAAGACAATTTTGGTCTGGAGCATGACGATTAGC
TCGTCCTTGGTTACTCGTATTCTTATAGATCATCAAATCATCTAGTTCGTTTCGTCTGACATCCTCCAATCTGATAGTTGTAAATCTCTATCATTACTTT
ATGAATGACACTCATATATACTACTATTTTACGTTATACGCGTATGCTTTGTTTATTGTTGCTTTGATATTTTTTTAATCTATCTTAGATCTCATAATCC
GAAAGTCATTACCATTAGGAAGAATACAATGATAATGAAAGCTGGAGTGGTTTATATTTAATTGAGTATAAATTATATTTAGAAAGCTTTATTTTTGGTA
TAATATATTAATAGATTATAAAATATAATTTATTTATTCTCATTTAATTTCCCTTTTTTTTATCAGATAAAAACATACCTGAAATAAAAAAACCAAATTA
AAGTCAACTACTAAACTTATTTTTTATTTTCTTTTTTCTCCTTAATTATTAAGAAATTATTTTATTATAACATAAAATTAATATAGCTCTTTTCTATTAT
AAGTTTTTTTATTATATGTATAATACTTCCTGCTCCATTACGATTTCTAAGTGTCATTTTTTATCTGTTATAGTCTATTAAATAATAATCAAACAATGTT
TGCTTCATATATTCAAATATTTCTAATATTATTCATTATTTTATTTTTTTGTTTACTTTTCTCTTCTTTTCAGCCCT
>LE_HBa0004G22_T7_1099 (trimmed for quality and cloning vector)
AGTCGACCTGCAGGCATGCAAGCTTGTTTTAAGTCAACAATATTGCAGATCTTGTAGCCTGGGAACTGCATTCCAAGGTAATGAATGCATCAAGATGGAA
ATGACAACTGGATCACTGTATCACATTCCTGGTAGTTCGTGTAAT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961345
Expected error %
1.19256
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004G22
Clone
Clone name
hba-4g22
LE_HBa0004G22
P004G22
Clone type
BAC
Contamination
none
Estimated length
128,227
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found