Clone Read LE_HBa0194N05_SP6_110064

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0194N05_SP6_110064
Primer
SP6
ID from Seq. Facility
LE_HBa_194_N05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
518 trimmed for vector and quality, 966 raw
Genbank Accession
Sequence
>LE_HBa0194N05_SP6_110064 (raw untrimmed)
CCTGAATTGGGAGTCTAGAAAGTCAGATACTGGGGAGAATACCTATCGCAGTGCAATCAACTCACAACCCAGCCACCTATGAGATTCGTGAAGAGATGGC
TCAGATGAGAACTGAGCTTGGGTTGGTATTAAAACATATCACTGGGGGTGCAGAAAAGATAAATGCAGTTAACTACTTGTCTAAACCACCACCACCAAAT
GATGAATGCTATTATGCAGAGGATTCCTATGCGGTAAATGAGCAGACAGGGGGTTTCCGACCGAGTGCCCAAGGCTCAAATCAAGATAATTGGCGCCAAG
GTCAAGGAAACCAAGGTCGGATCTATGGTAACTATAACCGTGAGGGTCATTATGTCCGAGATGGAAACTACAACCGCGACAACAACTTCAACAGGGGTAA
CTATGGTAACAAAAATGATAAGAATGGGTCCTATGTTCCTCCTCAAAATTGTGAAGTTACTCCTAGGGATGGTGGATATAGTATGTCGCGAGTTGAGGAT
ATGTTGCAAAAAAAGATGAGGAGGTTCGATGCTATGGATGAGCACATTAATAAGTTAAGGAGTGATTTAGCGGGTATTGAGCAATAATTCAATACACCTG
CTATATCGATTTATACATATCGAGTTTGAAATGGTCTAAATATCTGCTACCTGTGAACACTCTGTGACCCTGCCTCCTTTCCTAGCAACATTGTCCTACA
CCCCAAACATTGATTTCCCCCCTATTGGCATTCCCTCCTCTTGTTGTGTATCAATCCTCTCTCTCTCCCTCGCTTCTAATTACTAAAAGTTCAGCAAGAG
ATTTCTATTTCCCCCCTCCAATTTTTAAAATTTATATTTTATATTTTATATTTATTATATTTGTATTTATTAATTTTTTAAGATATTTTNTTTATTTAGT
AATATTATTAGTGTTAAGAAAAATTATATAAATAGTTTTTTTTATTTTTTTTATAGATAAATTTAA
>LE_HBa0194N05_SP6_110064 (trimmed for quality and cloning vector)
GCAGTGCAATCAACTCACAACCCAGCCACCTATGAGATTCGTGAAGAGATGGCTCAGATGAGAACTGAGCTTGGGTTGGTATTAAAACATATCACTGGGG
GTGCAGAAAAGATAAATGCAGTTAACTACTTGTCTAAACCACCACCACCAAATGATGAATGCTATTATGCAGAGGATTCCTATGCGGTAAATGAGCAGAC
AGGGGGTTTCCGACCGAGTGCCCAAGGCTCAAATCAAGATAATTGGCGCCAAGGTCAAGGAAACCAAGGTCGGATCTATGGTAACTATAACCGTGAGGGT
CATTATGTCCGAGATGGAAACTACAACCGCGACAACAACTTCAACAGGGGTAACTATGGTAACAAAAATGATAAGAATGGGTCCTATGTTCCTCCTCAAA
ATTGTGAAGTTACTCCTAGGGATGGTGGATATAGTATGTCGCGAGTTGAGGATATGTTGCAAAAAAAGATGAGGAGGTTCGATGCTATGGATGAGCACAT
TAATAAGTTAAGGAGTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972195
Expected error %
0.513703
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 148 E Value 6e-35 Identity 24.30% Align. Length 275bp (53.09%) Frame 2
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0194N05
Clone
Clone name
hba-194n5
LE_HBa0194N05
P194N05
Clone type
BAC
Contamination
none
Estimated length
85,850
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found