Clone Read LE_HBa0194N05_T7_110065

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0194N05_T7_110065
Primer
T7
ID from Seq. Facility
LE_HBa_194_N05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
633 trimmed for vector and quality, 802 raw
Genbank Accession
Sequence
>LE_HBa0194N05_T7_110065 (raw untrimmed)
CCCGGTACCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATCAAGAAGGTGGCAATGCCCCCCGGAGCTGTTTCCTTGGAGGATGTGG
ATCTTGATCAAGTTAGCGTTGATTTTGTCCTCAATTGTGCAAGAAAAGGTAGGGAATGTCCACCACAAAATATAGCCTCTTCTTATTTGCTTTAAAATAT
ATTGCATTTGCAATCATCAAGTCAGGATTGATGTCGTATTTTTGTAGGCGGACTTCTTGAACTATCTGAAGCTATTAGAGATTATCATCACAGTACTCTG
TTCCCTCATATGGTAAATTCGAACTTGCACATACATTATTATCTGTTCAATGGGGTCACTATTTATGAATGTTCTTATTCGGGATTGCACATACATTGAT
TTCTGTTCAATAGTTACTATTTGTGAGTGTTCCAGTTCCCGAGGCGTTATCTATTGCAGCTTAGAATTATTTCCATATGGGGTTGTTTTTACCTATCCCA
GAACATTATTTCATGCGTTCTATGCACATTAATGTTCATTTTCATTCTTCAACGGTTTCCTTTTTGTATTTAGAGTAATGCAGGTTCAACTGATGAATTC
TTTCTAGCTACAAATCCTGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCATTTTGCCAACATCTCTATTT
CAGATTCATTTGAACTGAACTCTTTGAAGAACTTTTCATTTTATTCATATCTCTAGTTTCTCACTTTACACAACAACAAAAGGTAAACATTTGACAACTT
GA
>LE_HBa0194N05_T7_110065 (trimmed for quality and cloning vector)
AGCTTAATCAAGAAGGTGGCAATGCCCCCCGGAGCTGTTTCCTTGGAGGATGTGGATCTTGATCAAGTTAGCGTTGATTTTGTCCTCAATTGTGCAAGAA
AAGGTAGGGAATGTCCACCACAAAATATAGCCTCTTCTTATTTGCTTTAAAATATATTGCATTTGCAATCATCAAGTCAGGATTGATGTCGTATTTTTGT
AGGCGGACTTCTTGAACTATCTGAAGCTATTAGAGATTATCATCACAGTACTCTGTTCCCTCATATGGTAAATTCGAACTTGCACATACATTATTATCTG
TTCAATGGGGTCACTATTTATGAATGTTCTTATTCGGGATTGCACATACATTGATTTCTGTTCAATAGTTACTATTTGTGAGTGTTCCAGTTCCCGAGGC
GTTATCTATTGCAGCTTAGAATTATTTCCATATGGGGTTGTTTTTACCTATCCCAGAACATTATTTCATGCGTTCTATGCACATTAATGTTCATTTTCAT
TCTTCAACGGTTTCCTTTTTGTATTTAGAGTAATGCAGGTTCAACTGATGAATTCTTTCTAGCTACAAATCCTGCTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.924545
Expected error %
0.735856
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g06970.1 Score 74 E Value 7e-14 Identity 14.30% Align. Length 335bp (52.92%) Frame 2
68418.m00789 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB11155.1| Score 74 E Value 3e-12 Identity 14.30% Align. Length 335bp (52.92%) Frame 2
unnamed protein product [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO11640.1| Score 74 E Value 3e-12 Identity 14.30% Align. Length 335bp (52.92%) Frame 2
At5g06970/MOJ9_14 [Arabidopsis thaliana] gb|AAL91294.1| AT5g06970/MOJ9_14 [Arabidopsis thaliana] ref|NP_196314.2| expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0194N05
Clone
Clone name
hba-194n5
LE_HBa0194N05
P194N05
Clone type
BAC
Contamination
none
Estimated length
85,850
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found