Clone Read LE_HBa0194N16_T7_110087

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0194N16_T7_110087
Primer
T7
ID from Seq. Facility
LE_HBa_194_N16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
239 trimmed for vector and quality, 802 raw
Genbank Accession
Sequence
>LE_HBa0194N16_T7_110087 (raw untrimmed)
GGGGACCCCCCCCCTAAAATATCGCACATACAGTTACCCAAAGCAAACCACTCTGAAGCCCTTCCATTGCAGGACTAACGTTTCCAATAAAGTAACCTCC
ACGTGTAGGCACAAAATCAAATACCCACTCTGGGATTGAATCAGGAATAACATTAAACTTATTTACTGCTGTGTGAGAATACTCTTCAGTTTTATAGCTA
TATATGTCATTTAACTGTTTGAAAGTCGAGCCACAAATAACTTCGCATATGATAACTCATGGCATGCAGGCGCTTCACTATTCTTTCAATGAATTCTTTC
CCTTCTGTATCGCGCTTCTTCATGTTCCAATGCAGATCTTAGTGCCATGAACAAAATAGCTTGGATCTCACTAGGATATCCTAAAACACCCTGATAATCA
ACCACAATATAAATTAGTATCCAATTAATGTCTTTTTTAGAAAAAAACATCAATCTTGGATCCTAAATTTTGGAGGCAAGAAAACAGTTTGTGTTACTGT
TTCTTTTTATGCTTCATAATCACAGTCATCTAAGAAATGATCAAAGGGCAACTCTACAAGGGCTTATAATTTCATCCCTCTCTATATTACATCTCTTTTA
CCTTTTAAAACTTTTTCTGTATCATTTGCCATATTATTAAACATTAACACTTTTACTTTTCATTAATTATTCTATGTTTCTCCTTCTTAATCATTTCACT
TTTACATCTATAATATTATAACAATTTGTAAATTTAATCTTCTAGTCTTATATATTTTTTCATGATTGGTATAGAAATACCTCTCTTAATGTACTTAAGT
CT
>LE_HBa0194N16_T7_110087 (trimmed for quality and cloning vector)
AGGACTAACGTTTCCAATAAAGTAACCTCCACGTGTAGGCACAAAATCAAATACCCACTCTGGGATTGAATCAGGAATAACATTAAACTTATTTACTGCT
GTGTGAGAATACTCTTCAGTTTTATAGCTATATATGTCATTTAACTGTTTGAAAGTCGAGCCACAAATAACTTCGCATATGATAACTCATGGCATGCAGG
CGCTTCACTATTCTTTCAATGAATTCTTTCCCTTCTGTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961315
Expected error %
1.45577
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g22650.1 Score 105 E Value 2e-35 Identity 92.20% Align. Length 234bp (97.91%) Frame 2
68414.m02830 beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative similar to neutral invertase [Daucus carota] GI:4200165; contains Pfam profile PF04853: Plant neutral invertase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g72000.1 Score 103 E Value 1e-34 Identity 86.30% Align. Length 237bp (99.16%) Frame 2
68414.m08322 beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative similar to neutral invertase [Daucus carota] GI:4200165; contains Pfam profile PF04853: Plant neutral invertase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAG30577.1| Score 107 E Value 1e-33 Identity 94.10% Align. Length 234bp (97.91%) Frame 2
putative neutral/alkaline invertase [Lotus corniculatus var. japonicus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM65926.1| Score 105 E Value 1e-33 Identity 92.20% Align. Length 234bp (97.91%) Frame 2
putative invertase [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0194N16
Clone
Clone name
hba-194n16
LE_HBa0194N16
C06HBa0194N16
P194N16
Clone type
BAC
Contamination
none
Estimated length
83,863
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found