Clone Read LE_HBa0194O14_T7_110131

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0194O14_T7_110131
Primer
T7
ID from Seq. Facility
LE_HBa_194_O14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
586 trimmed for vector and quality, 813 raw
Genbank Accession
Sequence
>LE_HBa0194O14_T7_110131 (raw untrimmed)
TTGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCTTTAAATCTTAGTCACACCTTGTTATCTCATAAAACACCAGGCACTAGC
CTCCATTTCAATCACCTCGCAAAAATGTAATGTGTACAAAGTTAATATTTGGGTCACTCTATGAAGGATTAAATGTATATCAACGACATTTTTTTAGCTT
TTTTTTTTTATAAAAAAAATAGATCATCTCAATGTTTATGTGATAAAAGGTGAAGTCTTGCCTTTTTTGTGCAACCATGAAAAGTAAAGATGAATTGATG
TAGGCCTTTTGCTTTTTAACTATAATAAAATATACAATTATATTTAGGCGAAATGATCTGATGAACCCCTATACTTGTATACATTTGTATTATGAACTCA
AACTTAACCATTTGTCAATTGAATCCTCCAACACATTAAAATACAATATTTCAAACCCACCATTGATCATGCTTATGTGACATTAAAATGATTGAATTGG
TGAGAGAGTGTAACACACACACTCAAAAGTAAGTGAAGAACATATTTAATTTTTAAAAATATAAAATAATATCTTTTTAAAAAAAGTTTCTTCTTCCTCT
CACCTCATCTTCTTCATTCATCCCCCACCCTCACTCTTTATCATCGCCTCTACCTTTCTTATTAACCAACCTGCTAACTTAATCCCCCTTTTCAGCTATC
CCTCACTCAAAATCTGTCCTAACCCCCCTTTTTAACTATTCCCAACTCCATTTTTGTTACATATCCTTTTTTAAGGTTCCACTATATCCCCTCTCCATCC
TATATCTCTATTT
>LE_HBa0194O14_T7_110131 (trimmed for quality and cloning vector)
AGCTTATCTTTAAATCTTAGTCACACCTTGTTATCTCATAAAACACCAGGCACTAGCCTCCATTTCAATCACCTCGCAAAAATGTAATGTGTACAAAGTT
AATATTTGGGTCACTCTATGAAGGATTAAATGTATATCAACGACATTTTTTTAGCTTTTTTTTTTTATAAAAAAAATAGATCATCTCAATGTTTATGTGA
TAAAAGGTGAAGTCTTGCCTTTTTTGTGCAACCATGAAAAGTAAAGATGAATTGATGTAGGCCTTTTGCTTTTTAACTATAATAAAATATACAATTATAT
TTAGGCGAAATGATCTGATGAACCCCTATACTTGTATACATTTGTATTATGAACTCAAACTTAACCATTTGTCAATTGAATCCTCCAACACATTAAAATA
CAATATTTCAAACCCACCATTGATCATGCTTATGTGACATTAAAATGATTGAATTGGTGAGAGAGTGTAACACACACACTCAAAAGTAAGTGAAGAACAT
ATTTAATTTTTAAAAATATAAAATAATATCTTTTTAAAAAAAGTTTCTTCTTCCTCTCACCTCATCTTCTTCATTCATCCCCCACC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.921809
Expected error %
0.179275
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0194O14
Clone
Clone name
hba-194o14
LE_HBa0194O14
P194O14
Clone type
BAC
Contamination
none
Estimated length
64,402
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found