Clone Read LE_HBa0197C03_T7_110301

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0197C03_T7_110301
Primer
T7
ID from Seq. Facility
LE_HBa_197_C03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
633 trimmed for vector and quality, 952 raw
Genbank Accession
Sequence
>LE_HBa0197C03_T7_110301 (raw untrimmed)
CATAGCGGGGCCCGTGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTAAAATGAATAAAGACAAGAGTGCCGAAATAAAGGAATGAATAATGT
TCATTTTGTGAGAAACCCCCAGGAAATAAACATTTGATGGATTGAAGCAAAAGAACCAACGAGTTTTATTTGAAGGAGTCTAAAGAGGCAAGTAGTTTTA
ATCAAAGGAGTCTCACTTAAAGTAAACTCTTAAAGTTACTGCGGAATTAAACTATTGGAGTTTGACTACAATACGAAATAATTATTTAATGTAATTTGAA
GAAGAAGTCCAAAGAAGCTAGGAGTTTGAATTAAAGAAGGAGTCTTACTTCAAGTAGAACTCTAAGTCAAGAGAGTTCAAGTCAATAAGGTGTTTGAAGT
ATACAATAACTATATAAAATATTGTGCTTAAATAGAAGTGAAGTCGTCCAGAATACATGTGCACATACAGAGTAAAAAAGCAATTGAAAAATTGACTTCA
CAAGCGCTACCAACAAACTAAAGGAACACATAAAAGGAACATTTTGAAGAACCTGATCCTTTACAAAGTTTATGTGTTAAGAGTTTTTCTTTGTAAATAA
GTCTTAATGTACTCTCATTTCAGTGAGTTATAGACTAAATTAGGAGTGTTGTTTCCATGTTGTAATATCATTATGAGTTTTGTGAACTCTTTTATGTGTT
ACCATCTTTTATTTTCAATGTTTATAATCGCATCTTATTCTATGATTTTACTCTGATCTGCAACCGTGCCTTTCACATTTGTTCATGGTAACCCCTATCA
TTTCTTTTTAGCCTATTTTATAAATTATATAAACGTTCATCCATACTTCATCCTCTGCTCCATCACTTCCCCTACGATTTATCTTTCACTGTCACTCTAT
AGTGCATTAAGAATATCTTAACGCGCAGTCGCTCCCCTTACGTTTTCTTCTC
>LE_HBa0197C03_T7_110301 (trimmed for quality and cloning vector)
AGCTTCTAAAATGAATAAAGACAAGAGTGCCGAAATAAAGGAATGAATAATGTTCATTTTGTGAGAAACCCCCAGGAAATAAACATTTGATGGATTGAAG
CAAAAGAACCAACGAGTTTTATTTGAAGGAGTCTAAAGAGGCAAGTAGTTTTAATCAAAGGAGTCTCACTTAAAGTAAACTCTTAAAGTTACTGCGGAAT
TAAACTATTGGAGTTTGACTACAATACGAAATAATTATTTAATGTAATTTGAAGAAGAAGTCCAAAGAAGCTAGGAGTTTGAATTAAAGAAGGAGTCTTA
CTTCAAGTAGAACTCTAAGTCAAGAGAGTTCAAGTCAATAAGGTGTTTGAAGTATACAATAACTATATAAAATATTGTGCTTAAATAGAAGTGAAGTCGT
CCAGAATACATGTGCACATACAGAGTAAAAAAGCAATTGAAAAATTGACTTCACAAGCGCTACCAACAAACTAAAGGAACACATAAAAGGAACATTTTGA
AGAACCTGATCCTTTACAAAGTTTATGTGTTAAGAGTTTTTCTTTGTAAATAAGTCTTAATGTACTCTCATTTCAGTGAGTTATAGACTAAATTAGGAGT
GTTGTTTCCATGTTGTAATATCATTATGAGTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.910838
Expected error %
0.637832
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0197C03
Clone
Clone name
hba-197c3
LE_HBa0197C03
C07HBa0197C03
P197C03
Clone type
BAC
Contamination
none
Estimated length
113,778
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found