Clone Read LE_HBa0050N22_SP6_11034

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050N22_SP6_11034
Primer
SP6
ID from Seq. Facility
LE_HBa_050_N22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
726 trimmed for vector and quality, 846 raw
Genbank Accession
Sequence
>LE_HBa0050N22_SP6_11034 (raw untrimmed)
AAAATGGCNTNCNNTTACCTATGTAGACANTTTGATATGCTTCTTATACGACATATGGTCCATCCCACTTTGAGGTAAATTTTCCCCCAGACTTGTGCGA
AGTAATGATTGGTCTTCTTACCGCGAGAATTTGATCTCCAACGTGAAAGAACCTCAAGAGAACCTTCTTATTAAAAGCACGAGATAGACGAGCTTGATAA
CATTCAAGGTTTTGTTGGGCTTCTAACCTCATTTCTTCAAGTGCTTCTAACTAAGCAAGACGCAATCGAGCATTTTCTTCCTCATTAAGCCCTTCTTGAA
TAGCAAGTCTTAAGGAGGGTATTTGACGCTCGAGTGGCAGGACTGCTTCAACTCCAAAAGCAAGTGAATATGGTGTTGCTTGAGTTGGTGTGCGATATGT
TGTCCTATATGCCCACAAAGCTTCTTCCATTCTTTCATGTCAATCCCGTTTGGATTTTGAGAAAACTTTCTTGAGCAGGTTGCATAGAGTCTTATTGAAC
GCTTCAGCAAGACCATTAGCGGCAGCATGATACATAGAAGATTTACGCTGCTTAAAGTCAAAAATATCACAAATCTTGTTCATTAACTTGTTATCAAATG
GTTTGACATTGTCTGTTATTATATAGCGAGGGATGCCAAAGCAATAGATAATATTTACTCGGATAAAATTTGCAACATTCTATTTCTTCACCTATTTAAG
AGCGACAGCTTCAGCACATTTTGAAATGTAATCAGTTGCAGCCAAGATGTACAAGTGTCCACCAGAAGACTTTGGTAATGGTCCGACAATATCAAGTCCC
AAGCGGTCAAATGGGCCAAGATGCGATGGTTGGGGTTGCAATACTC
>LE_HBa0050N22_SP6_11034 (trimmed for quality and cloning vector)
TGATATGCTTCTTATACGACATATGGTCCATCCCACTTTGAGGTAAATTTTCCCCCAGACTTGTGCGAAGTAATGATTGGTCTTCTTACCGCGAGAATTT
GATCTCCAACGTGAAAGAACCTCAAGAGAACCTTCTTATTAAAAGCACGAGATAGACGAGCTTGATAACATTCAAGGTTTTGTTGGGCTTCTAACCTCAT
TTCTTCAAGTGCTTCTAACTAAGCAAGACGCAATCGAGCATTTTCTTCCTCATTAAGCCCTTCTTGAATAGCAAGTCTTAAGGAGGGTATTTGACGCTCG
AGTGGCAGGACTGCTTCAACTCCAAAAGCAAGTGAATATGGTGTTGCTTGAGTTGGTGTGCGATATGTTGTCCTATATGCCCACAAAGCTTCTTCCATTC
TTTCATGTCAATCCCGTTTGGATTTTGAGAAAACTTTCTTGAGCAGGTTGCATAGAGTCTTATTGAACGCTTCAGCAAGACCATTAGCGGCAGCATGATA
CATAGAAGATTTACGCTGCTTAAAGTCAAAAATATCACAAATCTTGTTCATTAACTTGTTATCAAATGGTTTGACATTGTCTGTTATTATATAGCGAGGG
ATGCCAAAGCAATAGATAATATTTACTCGGATAAAATTTGCAACATTCTATTTCTTCACCTATTTAAGAGCGACAGCTTCAGCACATTTTGAAATGTAAT
CAGTTGCAGCCAAGATGTACAAGTGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972435
Expected error %
0.0203501
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_493776.1| Score 209 E Value 4e-53 Identity 15.40% Align. Length 722bp (99.45%) Frame 1
unnamed protein product [Oryza sativa (japonica cultivar-group)] dbj|BAB08213.2| Similar to Arabidopsis thaliana chromosome II BAC F26H6; putative retroelement pol polyprotein (AC006920) [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_462905.1| Score 156 E Value 4e-37 Identity 14.40% Align. Length 596bp (82.09%) Frame 1
putative gag-pol precursor [Oryza sativa (japonica cultivar-group)] gb|AAK92670.1| putative gag-pol precursor [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050N22
Clone
Clone name
hba-50n22
LE_HBa0050N22
P050N22
Clone type
BAC
Contamination
none
Estimated length
50,546
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found