Clone Read LE_HBa0050N24_SP6_11038

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050N24_SP6_11038
Primer
SP6
ID from Seq. Facility
LE_HBa_050_N24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
766 trimmed for vector and quality, 814 raw
Genbank Accession
Sequence
>LE_HBa0050N24_SP6_11038 (raw untrimmed)
CTAAAGCTAGTGTAGCTANCTAGATTCATCGGACCCAATACTTTTGCAGAGCATAATTTTATGAGTAAGCATACACTGAAATTGCAATAAATAATATATA
TAAACCTATAACTTTAAGAATACAATGTGTTTAAGATTGATACTTATAAAGTTTAAACCTATAAACCTTAAAATTTATTTATATGTGCAGCTGAGAATGA
CTTACTAAATTCAGAAGTTTGAAACAGATTCTATGAGTGTGTTGCTAAGTTGGTCCATGATATTACTGAGGAAGATATTATAATGGAGCATCTTAACTTG
CAAGAATTTTTCAGAAATTTGCATTGGCTATTGCACAAAGAAAGACAAGGTCACTAGGTGAATGAGGATCTATCTTTATAATTTTAACTCTTTAAGTTAA
TTCTTTATACTGTAGTTATTAGCTTTTGAGTATTTGTTCTACTTCCAAGTTGAATGGTGGTTCTTTCACTCCATACTCGCAACATTTCTGCCATCAAAGT
TCTAAGTCTAACTTGTATATCATTCAAACGTGAGAGGAACTGACAGCATGTAAGACGAACAATTCAGTATATATAATTACTAAGCAATGTTTCAATTTTC
AGCAAGAAAAGTGTATCCAAAATAAGCAAACTACTTCATTCAACAATGGTTTCCAACTTAAAAGTAAACGAACGAACGAACCTGTTGGATGATCCTACGC
TTGTTATGTCCAGCAGCAAGATCGTCAAGATTGACAATTTTCTTAATATTAGTGGTCATATCACGAACAAGCTTAAACTGAACATCAGCTTGAAGAAGAG
CACGAGTGATTTCA
>LE_HBa0050N24_SP6_11038 (trimmed for quality and cloning vector)
AGATTCATCGGACCCAATACTTTTGCAGAGCATAATTTTATGAGTAAGCATACACTGAAATTGCAATAAATAATATATATAAACCTATAACTTTAAGAAT
ACAATGTGTTTAAGATTGATACTTATAAAGTTTAAACCTATAAACCTTAAAATTTATTTATATGTGCAGCTGAGAATGACTTACTAAATTCAGAAGTTTG
AAACAGATTCTATGAGTGTGTTGCTAAGTTGGTCCATGATATTACTGAGGAAGATATTATAATGGAGCATCTTAACTTGCAAGAATTTTTCAGAAATTTG
CATTGGCTATTGCACAAAGAAAGACAAGGTCACTAGGTGAATGAGGATCTATCTTTATAATTTTAACTCTTTAAGTTAATTCTTTATACTGTAGTTATTA
GCTTTTGAGTATTTGTTCTACTTCCAAGTTGAATGGTGGTTCTTTCACTCCATACTCGCAACATTTCTGCCATCAAAGTTCTAAGTCTAACTTGTATATC
ATTCAAACGTGAGAGGAACTGACAGCATGTAAGACGAACAATTCAGTATATATAATTACTAAGCAATGTTTCAATTTTCAGCAAGAAAAGTGTATCCAAA
ATAAGCAAACTACTTCATTCAACAATGGTTTCCAACTTAAAAGTAAACGAACGAACGAACCTGTTGGATGATCCTACGCTTGTTATGTCCAGCAGCAAGA
TCGTCAAGATTGACAATTTTCTTAATATTAGTGGTCATATCACGAACAAGCTTAAACTGAACATCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.942765
Expected error %
0.197932
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA84288.1| Score 72 E Value 2e-11 Identity 33.30% Align. Length 104bp (13.58%) Frame 2
54-kD signal recognition particle (SRP) specific protein [Lycopersicon esculentum] pir||S51598 signal recognition particle 54K protein - tomato (cv. UC82-B) sp|P49972|SR52_LYCES SIGNAL RECOGNITION PARTICLE 54 KD PROTEIN 2 (SRP54)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050N24
Clone
Clone name
hba-50n24
LE_HBa0050N24
P050N24
Clone type
BAC
Contamination
none
Estimated length
71,469
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found