Clone Read LE_HBa0050N24_T7_11039

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050N24_T7_11039
Primer
T7
ID from Seq. Facility
LE_HBa_050_N24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
747 trimmed for vector and quality, 785 raw
Genbank Accession
Sequence
>LE_HBa0050N24_T7_11039 (raw untrimmed)
CCGGGACCCGCGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGATACTATACTACACTACACATCATCAAGCACATCCTAGAAGCTTTACTTA
ATTATATATATCTTCACAACCGCCTATATAAATTTGCCTCAATATAATTCCTTCTCATCATAGAAATCAGAAAAGCTAATCGGTGAGTGTTTCTTATTAA
AGTACACATAAGAAAATTTCAATTAATTTATTAGCAATGTCTTTGTCAGGCTTAGTTTTGAAAAATATCTATAAAAAATCGAATGCAAGTGTGAGGCATT
TGAGTAATAATGTGCAGAAACAGGGCTGGTGCTCTGAACTTGTACGTCGTTTTTCTACAGAGTCTGAGAAACAACAAGTAGATGGCAGTGGAAAATCGGA
GAAACAAGAAGTAGCTGTTTCCGACAGTGGCAAACAATCGAAGCTATTTCAAAGAAGACGCCGCCGTGGTAATCTTTGGAGACGCAATGAATACGACTTT
GCACCTGCTCTTGTCGGTATGATTTCCCCTTTCTATTTAGTAGTCTTAATGAAATGATTTAGAATTTATTATTATTTTTAAAGCTAAATTAATTTATATA
TTAAAATGGAGAGAGTATTATCTTTTGCAATTTTCAATTATTAAGAATATTTTTTTTAGGCATAATACATACATACATGTTAACCCTTTATCATGACACT
TTCGTGTCAGCTAGTAACTATGACTTTTAATTTTAAATGTGTATAAATAGTATATTTAATTGTTTAAAATTGAATAAATAGATAT
>LE_HBa0050N24_T7_11039 (trimmed for quality and cloning vector)
TCTAGAGTCGACCTGCAGGCATGCAAGCTTTGATACTATACTACACTACACATCATCAAGCACATCCTAGAAGCTTTACTTAATTATATATATCTTCACA
ACCGCCTATATAAATTTGCCTCAATATAATTCCTTCTCATCATAGAAATCAGAAAAGCTAATCGGTGAGTGTTTCTTATTAAAGTACACATAAGAAAATT
TCAATTAATTTATTAGCAATGTCTTTGTCAGGCTTAGTTTTGAAAAATATCTATAAAAAATCGAATGCAAGTGTGAGGCATTTGAGTAATAATGTGCAGA
AACAGGGCTGGTGCTCTGAACTTGTACGTCGTTTTTCTACAGAGTCTGAGAAACAACAAGTAGATGGCAGTGGAAAATCGGAGAAACAAGAAGTAGCTGT
TTCCGACAGTGGCAAACAATCGAAGCTATTTCAAAGAAGACGCCGCCGTGGTAATCTTTGGAGACGCAATGAATACGACTTTGCACCTGCTCTTGTCGGT
ATGATTTCCCCTTTCTATTTAGTAGTCTTAATGAAATGATTTAGAATTTATTATTATTTTTAAAGCTAAATTAATTTATATATTAAAATGGAGAGAGTAT
TATCTTTTGCAATTTTCAATTATTAAGAATATTTTTTTTAGGCATAATACATACATACATGTTAACCCTTTATCATGACACTTTCGTGTCAGCTAGTAAC
TATGACTTTTAATTTTAAATGTGTATAAATAGTATATTTAATTGTTT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946839
Expected error %
0.0399885
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|M19092.1:1-90 Score 62 E Value 8e-11 Identity 100.00% Align. Length 30bp (4.02%) Frame 2
Cloning vector pJRD179 DNA
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U02430.1:1751-1832 Score 62 E Value 8e-11 Identity 100.00% Align. Length 30bp (4.02%) Frame 2
Cloning vector pMAMneoBlue
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050N24
Clone
Clone name
hba-50n24
LE_HBa0050N24
P050N24
Clone type
BAC
Contamination
none
Estimated length
71,469
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found