Clone Read LE_HBa0197E12_T7_110415

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0197E12_T7_110415
Primer
T7
ID from Seq. Facility
LE_HBa_197_E12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
636 trimmed for vector and quality, 995 raw
Genbank Accession
Sequence
>LE_HBa0197E12_T7_110415 (raw untrimmed)
GTAAACCGGGTCCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGTATATTTAATCTTTTCATGATATTTATTCTTTTATTTTATATTAC
TGACCATACATGAACAGGGATGGTGAAGGAACTTACAGGTGGCTATATAATCAAGTATCATGCGAAAGGGTTGGAGAGTGACCCAATTGAAATTGACTTC
ACTCCTCCCTTCAGGTTTGGGAGCTTTTCTGGTTTGTCATGTTTTGGTTTCGTTTACAAGGCACTAAGATACTTATGCGTTGCTTCTGCAGACGGATTGA
TATGGTAGAGGAATTGGAGAAGATTGCAAACTTGAATATACCCAAGGATCTCTCAAGTGATGAAACCAACAAATATCTCATAGATGCTTGCGCGAAGTTT
GAGATCAGATGTCCTCCACCTCTAACAACAACTAGATTACTTGATAAAGTAAATTTTCTTTCAGATATCTTCCGGATAGCCAATTTTTACATATGCAATC
TAGTAACTTGCTTTTCCTGCTGATCCCCTTTTCTTTTGTATTGTCGCGCACTACCCTCTAGCGATATTGCAATGTTTGAGAAATTTTTTCAGTTTCTGGG
CTTTGTGTTCTTCTGTTCTCTCCATGAGCAGTACTACATGAGGCAACAAAAAGGCTCCTGTAAAGAGGAGGGTGGAGGGTAATAGGCTAATGTTATTAAT
CAAGAGGAAAGAAATAGAGATGAATAGGGTTGCTAATCGTTTAGAGCTTTTTTAGTGTGAAATTTTTTTTTTTTTTGGCTATTAATTTATTTTTTTTTTT
TTGTTCCTTTACTCTCAAGTTGAACTTAAAATTGGTTTAATAATCTTTATGCTTTTTTCTGCCTATTGACCTTTTAATTAATAAAATTTTTTTTTTTTTT
TTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTCATTAATAAACACTGACTTACATGGAATGCTTTGTTTCTTATTTTTCATTAGCTATGATTATC
>LE_HBa0197E12_T7_110415 (trimmed for quality and cloning vector)
AGCTTATGTATATTTAATCTTTTCATGATATTTATTCTTTTATTTTATATTACTGACCATACATGAACAGGGATGGTGAAGGAACTTACAGGTGGCTATA
TAATCAAGTATCATGCGAAAGGGTTGGAGAGTGACCCAATTGAAATTGACTTCACTCCTCCCTTCAGGTTTGGGAGCTTTTCTGGTTTGTCATGTTTTGG
TTTCGTTTACAAGGCACTAAGATACTTATGCGTTGCTTCTGCAGACGGATTGATATGGTAGAGGAATTGGAGAAGATTGCAAACTTGAATATACCCAAGG
ATCTCTCAAGTGATGAAACCAACAAATATCTCATAGATGCTTGCGCGAAGTTTGAGATCAGATGTCCTCCACCTCTAACAACAACTAGATTACTTGATAA
AGTAAATTTTCTTTCAGATATCTTCCGGATAGCCAATTTTTACATATGCAATCTAGTAACTTGCTTTTCCTGCTGATCCCCTTTTCTTTTGTATTGTCGC
GCACTACCCTCTAGCGATATTGCAATGTTTGAGAAATTTTTTCAGTTTCTGGGCTTTGTGTTCTTCTGTTCTCTCCATGAGCAGTACTACATGAGGCAAC
AAAAAGGCTCCTGTAAAGAGGAGGGTGGAGGGTAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95772
Expected error %
0.192237
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g11710.1 Score 91 E Value 1e-29 Identity 72.20% Align. Length 337bp (52.99%) Frame 2
68416.m01435 lysyl-tRNA synthetase, putative / lysine--tRNA ligase, putative similar to SP|Q43776 Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) {Lycopersicon esculentum}; contains Pfam profile PF00152: tRNA synthetases class II (D, K and N)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT76338.1| Score 95 E Value 5e-30 Identity 77.80% Align. Length 337bp (52.99%) Frame 2
putative Lysyl-tRNA synthetase [Oryza sativa (japonica cultivar-group)] sp|Q6F2U9|SYK_ORYSA Lysyl-tRNA synthetase (Lysine--tRNA ligase) (LysRS)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF02138.1| Score 91 E Value 4e-28 Identity 72.20% Align. Length 337bp (52.99%) Frame 2
lysyl-tRNA synthetase [Arabidopsis thaliana] gb|AAM20403.1| lysyl-tRNA synthetase [Arabidopsis thaliana] gb|AAN72134.1| lysyl-tRNA synthetase [Arabidopsis thaliana] gb|AAD17333.1| lysyl-tRNA synthetase; LysRS [Arabidopsis thaliana] ref|NP_187777.1| lysyl-tRNA synthetase, putative / lysine--tRNA ligase, putative [Arabidopsis thaliana] sp|Q9ZPI1|SYK_ARATH Lysyl-tRNA synthetase (Lysine--tRNA ligase) (LysRS)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0197E12
Clone
Clone name
hba-197e12
LE_HBa0197E12
P197E12
Clone type
BAC
Contamination
none
Estimated length
118,586
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found