Clone Read LE_HBa0197K06_SP6_110690

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0197K06_SP6_110690
Primer
SP6
ID from Seq. Facility
LE_HBa_197_K06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
649 trimmed for vector and quality, 812 raw
Genbank Accession
Sequence
>LE_HBa0197K06_SP6_110690 (raw untrimmed)
TTTTTCTTTCTAGGACACTTAAGATGCATGAGAAAACTATCCAACTCGTAACCTCGATTTTGCAGGAGTGGTGTTTCCACTAATGATTTGGAGACATTAC
TTGTATGGTTTTCACGTAGATGTTTTCAAAGACCATAAGAGACTTTAGTATGTGATCACCTAGAAAGAGTTGAATATTCACCAGAGAACATGGATAGAGT
TCCTCAAAGATTATTATATGAGTGTGTAATTACCATCGTGGTAAGGCAAGTATAGTAGCAGATGCTCTTAGCTGACCATGTATGTGTAGTGTAGTACATG
TCAAGGAAGAAAGAAATGATTTCACTAAGGATGATCATAGACTTGGTCTCCTAAGAGTTTGTCTTATGAGCATACGAATGGTGGGGTAACGGTTTAGAAT
GGGGAAGAACCTTGTTAGATAGTGGAAGTTAAGGAAAAAAAGACAGTGATCCAATGTTTGTTGAGCAAACAGGTACAATCCACCAATAGAGAGTAGAGGT
TTTCTCCCAACGGGAAGATTGTGTATTTCAGTATCAGGGTTGATTATGTGCTACTAAGGTGGGTGAGGTAAGACATAAAATTCTTGTAGAAGCCCATAAC
TCTAAATATTCTATTCATACGGGCACCAATATAAATTATTGCGATTTGCAGGAAATCTATTAATGGACTGGTATAAGGAGAGATATAGCAGATTTTTATG
GGTAAGTGCCCCTATCGCCGGCAAGTCAAGGTAAAAACATCCAATAACGAGGAGTTTTGACTCCAGAGATTGACATTTCTTACCTGGAAGGGGGGAAGGT
TTAAAACACGGA
>LE_HBa0197K06_SP6_110690 (trimmed for quality and cloning vector)
AGATGCATGAGAAAACTATCCAACTCGTAACCTCGATTTTGCAGGAGTGGTGTTTCCACTAATGATTTGGAGACATTACTTGTATGGTTTTCACGTAGAT
GTTTTCAAAGACCATAAGAGACTTTAGTATGTGATCACCTAGAAAGAGTTGAATATTCACCAGAGAACATGGATAGAGTTCCTCAAAGATTATTATATGA
GTGTGTAATTACCATCGTGGTAAGGCAAGTATAGTAGCAGATGCTCTTAGCTGACCATGTATGTGTAGTGTAGTACATGTCAAGGAAGAAAGAAATGATT
TCACTAAGGATGATCATAGACTTGGTCTCCTAAGAGTTTGTCTTATGAGCATACGAATGGTGGGGTAACGGTTTAGAATGGGGAAGAACCTTGTTAGATA
GTGGAAGTTAAGGAAAAAAAGACAGTGATCCAATGTTTGTTGAGCAAACAGGTACAATCCACCAATAGAGAGTAGAGGTTTTCTCCCAACGGGAAGATTG
TGTATTTCAGTATCAGGGTTGATTATGTGCTACTAAGGTGGGTGAGGTAAGACATAAAATTCTTGTAGAAGCCCATAACTCTAAATATTCTATTCATACG
GGCACCAATATAAATTATTGCGATTTGCAGGAAATCTATTAATGGACTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.955974
Expected error %
0.112745
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38790.1| Score 97 E Value 1e-41 Identity 41.60% Align. Length 634bp (97.69%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 97 E Value 1e-41 Identity 41.60% Align. Length 634bp (97.69%) Frame 3
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0197K06
Clone
Clone name
hba-197k6
LE_HBa0197K06
P197K06
Clone type
BAC
Contamination
none
Estimated length
118,872
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found