Clone Read LE_HBa0197K06_T7_110691

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0197K06_T7_110691
Primer
T7
ID from Seq. Facility
LE_HBa_197_K06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 958 raw
Genbank Accession
Sequence
>LE_HBa0197K06_T7_110691 (raw untrimmed)
TTTAACCGGGTCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGGCAATAGGTATGAATGAGCGTGACTTTGTTCTGAGAGCGAGTGT
TAAAAAGTAATGTTATACTCAAGCTGAAATCATTGTGTGAAAAATGAGGATTTTGTTTTAAAGTGAGGACACTAGTTGCAATACCGGAATTGTTAGCACC
TCGGTGAGAAATTTAAGAGGATAGGTGTTAGTGCATAGTGAGTCTGTGTCATGTTATGATCCCACATAATTCAAGCCTAATAGTGATAGCATGCATAGAT
ATGATGATATTAATCGGGATTGATAGACAAATGATTGCAAAGGATAAAACCTGGATACTATTGTACAAAGATTTTGTATTGAGTCATAGTGTGTCGCTTG
AGGACAAACAACGAATTTAAGTTGAGGGTGTTGATATACCGTGGTTTCACGGTATTATTTATACTTTTTCCTTACGTTTAGTGTGTCCAAAAGCCTTTTT
GTGCTAATTTTGTATATAAGTTTCTCTTTATTTTGCAGGAAATCTATCCAAAGATGAATGCGGAGATTTTGAGCAAAGAAATGCAGAAGTGACCACCCAC
AGAGCTTATGACGGTCCGTCGTTCTTGTGACAGTCCGTACGTGGCAGCGTAATGCAGCTGCTGATGGAAGATGGGGAAGTCTGTACAAGTGTGGGCGTAC
AGAGTCCATGAAGATCTGTCGTGTCTATGACGGTCGTCACTGAATTCAAAGAACTAATCCATACCCTTATTTCAAGAATTAAGGATTTTTTGGACGACCA
ATCCGAGTGACTTCGTGTATTTATGGTCATTCGTTTTCTCTTCGTGGAAAAAAAAATAACTAATAGACATTTTTTTTTTTTTTGTTTTATTTTCTTTTTT
TTTTTTTACCTTCTTATCCCTCGTATTCCGTTTCCACTCTCGTTCTTCTATTCCTTCA
>LE_HBa0197K06_T7_110691 (trimmed for quality and cloning vector)
AGCTTATGGCAATAGGTATGAATGAGCGTGACTTTGTTCTGAGAGCGAGTGTTAAAAAGTAATGTTATACTCAAGCTGAAATCATTGTGTGAAAAATGAG
GATTTTGTTTTAAAGTGAGGACACTAGTTGCAATACCGGAATTGTTAGCACCTCGGTGAGAAATTTAAGAGGATAGGTGTTAGTGCATAGTGAGTCTGTG
TCATGTTATGATCCCACATAATTCAAGCCTAATAGTGATAGCATGCATAGATATGATGATATTAATCGGGATTGATAGACAAATGATTGCAAAGGATAAA
ACCTGGATACTATTGTACAAAGATTTTGTATTGAGTCATAGTGTGTCGCTTGAGGACAAACAACGAATTTAAGTTGAGGGTGTTGATATACCGTGGTTTC
ACGGTATTATTTATACTTTTTCCTTACGTTTAGTGTGTCCAAAAGCCTTTTTGTGCTAATTTTGTATATAAGTTTCTCTTTATTTTGCAGGAAATCTATC
CAAAGATGAATGCGGAGATTTTGAGCAAAGAAATGCAGAAGTGACCACCCACAGAGCTTATGACGGTCCGTCGTTCTTGTGACAGTCCGTACGTGGCAGC
GTAATGCAGCTGCTGATGGAAGATGGGGAAGTCTGTACAAGTGTGGGCGTACAGAGTCCATGAAGATCTGTCGTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.96304
Expected error %
0.838568
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0197K06
Clone
Clone name
hba-197k6
LE_HBa0197K06
P197K06
Clone type
BAC
Contamination
none
Estimated length
118,872
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found