Clone Read LE_HBa0050P05_SP6_11096

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050P05_SP6_11096
Primer
SP6
ID from Seq. Facility
LE_HBa_050_P05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
669 trimmed for vector and quality, 793 raw
Genbank Accession
Sequence
>LE_HBa0050P05_SP6_11096 (raw untrimmed)
AAAAAGAATGTGGTTACGANGACTTNNGGAGTTTANTGGAGGGTGAACAAGTCTTACTGAAGGTTTCACCCATGAAAGGGGTGATACGGTTTGGTAAGCG
AGGTAAGCTTAGTCCGAGGTACATTGGTGCATTTGAAGTTCTGAAGCGCGTGGGGGAGGTAGCTTATGAATTAGCTTTGCCCCCAGGACTCTCAGGAGTG
CACCTGGTATTTCTTGTGTCTATGCTGAAAAGATACCATGGGGATGGAAACTACATCATTCGTTGGGATTCAATTCTTCTTGATGAAAATTTTTCTTATG
AGGAGGAGCCTGTTGCCATTTTAGATAGAGAAGTCCGCAAGTTGAGGTCAAGGGAGATTGCATCCATCAAGGTTCAGTGGAAGAATCGACCAATTGAAGA
GTCCACTTGGGAGAAGGAGGCTGATATGCAAGAAAACTACCTACACCTGTTTACAGATTCAGGTACTCCTTTTCGCCCTTGTTTTTCTTCTTGTGATCGT
TCGGGGATGAACGATGGGTAAATTGGTATCTATTGTAATGACCTGTTAGTCTTTTTGAGCAGTAGAGTTTATTTCTAGTAATAACTGTCTGGGTCGATGG
ATCCCTCGACGGACCGTCGAGGGGGTCTCGTTCCAAAACACTTAGACTCTGGAAAATTGGGTACTGAGAACAACTCTCTGAACTTCGTGACGGAATGGCC
GGACGGACCGTTGCAGGCATGACGGGCCGTCCTAGACCTCTTAATGAAATTGAGTCTCTGAACTCTATGTCGACTCAGCAGGAACGACCGTCC
>LE_HBa0050P05_SP6_11096 (trimmed for quality and cloning vector)
GAGGGTGAACAAGTCTTACTGAAGGTTTCACCCATGAAAGGGGTGATACGGTTTGGTAAGCGAGGTAAGCTTAGTCCGAGGTACATTGGTGCATTTGAAG
TTCTGAAGCGCGTGGGGGAGGTAGCTTATGAATTAGCTTTGCCCCCAGGACTCTCAGGAGTGCACCTGGTATTTCTTGTGTCTATGCTGAAAAGATACCA
TGGGGATGGAAACTACATCATTCGTTGGGATTCAATTCTTCTTGATGAAAATTTTTCTTATGAGGAGGAGCCTGTTGCCATTTTAGATAGAGAAGTCCGC
AAGTTGAGGTCAAGGGAGATTGCATCCATCAAGGTTCAGTGGAAGAATCGACCAATTGAAGAGTCCACTTGGGAGAAGGAGGCTGATATGCAAGAAAACT
ACCTACACCTGTTTACAGATTCAGGTACTCCTTTTCGCCCTTGTTTTTCTTCTTGTGATCGTTCGGGGATGAACGATGGGTAAATTGGTATCTATTGTAA
TGACCTGTTAGTCTTTTTGAGCAGTAGAGTTTATTTCTAGTAATAACTGTCTGGGTCGATGGATCCCTCGACGGACCGTCGAGGGGGTCTCGTTCCAAAA
CACTTAGACTCTGGAAAATTGGGTACTGAGAACAACTCTCTGAACTTCGTGACGGAATGGCCGGACGGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.974468
Expected error %
0.019959
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 182 E Value 5e-45 Identity 20.00% Align. Length 425bp (63.53%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 176 E Value 5e-43 Identity 19.50% Align. Length 425bp (63.53%) Frame 2
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050P05
Clone
Clone name
hba-50p5
LE_HBa0050P05
P050P05
Clone type
BAC
Contamination
none
Estimated length
129,715
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found