Clone Read LE_HBa0050P05_T7_11097

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050P05_T7_11097
Primer
T7
ID from Seq. Facility
LE_HBa_050_P05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
758 trimmed for vector and quality, 805 raw
Genbank Accession
Sequence
>LE_HBa0050P05_T7_11097 (raw untrimmed)
CCTGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGTGCATATACAGGACTACTCTTTTCTTCTTCCTTCTCCTTCTTTATTGAT
AGGTGGTATTCCTTCACGTGAGTGAATGAAAGTTTGATTAAGAAAATTACCCTACTGAGCAAAAGAGTATAATTTGTAAAATAGACCTGTTTGAGATACA
TGCATATTTTTTTTAGGATAAAAATACATGCATATTCTGAGTTGATATAAGTTTAGAGCAGTTATTTTCACTTTGAAAGTATTATAGCAATTCTTTATTG
CGACAATGTTAATATTGTGAGAAATATTGGAGAAAATATTATTGAATTGCGTATCTAAATTGTTACATGAAGACCCTATTTATAGACACTACATTGGAAA
CCTTTTCCAATTTTTATTTCTATTGTTATTCCTATTCTAATTCCTATTCTAAGTAAGAAATACTTATTCCTATTCTAACACTCCCCCTCAAGGTGGTGAG
TTCAAATCATATGCACCTAGCTTGTCACAAATGTAATTAATACGAGGACATGTGAGAGATTTGATGAACATATCTGCAAGCTGATCATTTGACTTCACAA
ATTTTGTAACAATATCCCCTGACAGAATCTTTTCTCTGACAAAGTGACAGTCAATCTCAATGTGCTTAGTCCTTTCATGAAACACTGGATTTGATGCGAT
ATGAAGAGCCGCTTGATTACACACACAAGTTCCATCTGATCAATTTTGCCAAAATTTAGTTCTCCCAGTAACTGTTTGAGCTAAACTAACTCACAAGTTG
CTGTC
>LE_HBa0050P05_T7_11097 (trimmed for quality and cloning vector)
AGCTTAGTGCATATACAGGACTACTCTTTTCTTCTTCCTTCTCCTTCTTTATTGATAGGTGGTATTCCTTCACGTGAGTGAATGAAAGTTTGATTAAGAA
AATTACCCTACTGAGCAAAAGAGTATAATTTGTAAAATAGACCTGTTTGAGATACATGCATATTTTTTTTAGGATAAAAATACATGCATATTCTGAGTTG
ATATAAGTTTAGAGCAGTTATTTTCACTTTGAAAGTATTATAGCAATTCTTTATTGCGACAATGTTAATATTGTGAGAAATATTGGAGAAAATATTATTG
AATTGCGTATCTAAATTGTTACATGAAGACCCTATTTATAGACACTACATTGGAAACCTTTTCCAATTTTTATTTCTATTGTTATTCCTATTCTAATTCC
TATTCTAAGTAAGAAATACTTATTCCTATTCTAACACTCCCCCTCAAGGTGGTGAGTTCAAATCATATGCACCTAGCTTGTCACAAATGTAATTAATACG
AGGACATGTGAGAGATTTGATGAACATATCTGCAAGCTGATCATTTGACTTCACAAATTTTGTAACAATATCCCCTGACAGAATCTTTTCTCTGACAAAG
TGACAGTCAATCTCAATGTGCTTAGTCCTTTCATGAAACACTGGATTTGATGCGATATGAAGAGCCGCTTGATTACACACACAAGTTCCATCTGATCAAT
TTTGCCAAAATTTAGTTCTCCCAGTAACTGTTTGAGCTAAACTAACTCACAAGTTGCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.93987
Expected error %
0.473468
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40550.1| Score 147 E Value 2e-42 Identity 92.20% Align. Length 307bp (40.50%) Frame 1
putative receptor kinase [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38747.1| Score 108 E Value 2e-22 Identity 21.30% Align. Length 224bp (29.55%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050P05
Clone
Clone name
hba-50p5
LE_HBa0050P05
P050P05
Clone type
BAC
Contamination
none
Estimated length
129,715
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found