Clone Read LE_HBa0198E21_T7_111201

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0198E21_T7_111201
Primer
T7
ID from Seq. Facility
LE_HBa_198_E21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
513 trimmed for vector and quality, 950 raw
Genbank Accession
Sequence
>LE_HBa0198E21_T7_111201 (raw untrimmed)
AAAGCGGGACCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACTTTTTGCAATCTTTTTGTTTTGTTTGAAGTGCTAAAGTTTTGATTC
TCTTAGCTATGATAGTTGATGCCATAAAAAGTATAGTTCTACCTTATAGACATATCGCCAGTTCTTTCCAGTTTCAGTCAATCTTGTCCAGAGCACATTC
ATGACCATCTGACACTCGGAGCTGCAAAATACCTAAATAGATCAACCAGCTGAAGAAAAGACGCAGACAAATAATATTTTTTTTTGAAACGAAAAGACGC
AGACAAATACTTAATCAACTGAATCAAGAATATACAATGGCTAACTCGTACAATTTTTTTGTAGCCTGTGCTATCTCAGCCAAAGCAGTACCATGAGGGC
CCCAGGGCTCATCATCAGTAGCATCCAATACCTAGTACCATGTTGAAATAATCACATCATCCTTCAAACCAATGAAAAAAAAAGAAGAGGAGAGTCCAAA
GTACACCCCCCCCCCCCCCCCTTAATTTTATGTTGTTTATTTTATGTAAGAAGTTTAGTATTCGGATTTTTTTCTGCATTTTTCTTATCTTAAATATTAT
TCCTTAATTATGTAATCTAAAATAGATAGCAAAGAGCACAACTCTGGTGATGTTATCATCTTTATTTTTTTCCCATCAATTTTTTCTTTTTTTGGGTTTT
TCTTTTGTTTCTATTTATTATTGTTTTCTTTAATTTTTTCTTTTCTCCATTTTTATTTTTTAGTAATTTTTAAATATTAATATATTATATCAGACAAACA
TCGATCCAATATATGTATAACTTCACACCATCTTCACATCTCCCCCCCCCCCCTATTTTTTTTTTTTTTTTTTTTTTTTTCTTTTATAATTATATTATTA
TTTTTATATTTTATATATTTTATTATAGTATTTTCCTTTTTTTTTTTTTT
>LE_HBa0198E21_T7_111201 (trimmed for quality and cloning vector)
AGCTTAACTTTTTGCAATCTTTTTGTTTTGTTTGAAGTGCTAAAGTTTTGATTCTCTTAGCTATGATAGTTGATGCCATAAAAAGTATAGTTCTACCTTA
TAGACATATCGCCAGTTCTTTCCAGTTTCAGTCAATCTTGTCCAGAGCACATTCATGACCATCTGACACTCGGAGCTGCAAAATACCTAAATAGATCAAC
CAGCTGAAGAAAAGACGCAGACAAATAATATTTTTTTTTGAAACGAAAAGACGCAGACAAATACTTAATCAACTGAATCAAGAATATACAATGGCTAACT
CGTACAATTTTTTTGTAGCCTGTGCTATCTCAGCCAAAGCAGTACCATGAGGGCCCCAGGGCTCATCATCAGTAGCATCCAATACCTAGTACCATGTTGA
AATAATCACATCATCCTTCAAACCAATGAAAAAAAAAGAAGAGGAGAGTCCAAAGTACACCCCCCCCCCCCCCCCTTAATTTTATGTTGTTTATTTTATG
TAAGAAGTTTAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.958479
Expected error %
1.21268
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g59290.1 Score 43 E Value 3e-11 Identity 56.20% Align. Length 288bp (56.14%) Frame 2
68416.m06609 epsin N-terminal homology (ENTH) domain-containing protein contains Pfam PF01417: ENTH domain. ENTH (Epsin N-terminal homology) domain; similar to Af10-protein - Avena fatua, EMBL:U80041
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB68030.1| Score 54 E Value 4e-14 Identity 69.70% Align. Length 288bp (56.14%) Frame 2
Af10-protein [Avena fatua]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD41810.2| Score 53 E Value 2e-14 Identity 65.70% Align. Length 288bp (56.14%) Frame 2
OSJNBa0083N12.8 [Oryza sativa (japonica cultivar-group)] ref|XP_473754.1| OSJNBa0083N12.8 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0198E21
Clone
Clone name
hba-198e21
LE_HBa0198E21
C08HBa0198E21
P198E21
Clone type
BAC
Contamination
none
Estimated length
101,361
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found