Clone Read LE_HBa0050P24_SP6_11134

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0050P24_SP6_11134
Primer
SP6
ID from Seq. Facility
LE_HBa_050_P24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
698 trimmed for vector and quality, 810 raw
Genbank Accession
Sequence
>LE_HBa0050P24_SP6_11134 (raw untrimmed)
GTCGGTGGCAAGCTTTGATGCTGCAGCTCGAACTCTTCGTGGACCTAAAGCTAAAACTAATTTCCCTTTACCTATGTACTTTTAGAGGCATCAGTTCTAT
CGAAGTTTAAACCCTAATGCTTACCCGGGTGACCCGAGATTGTACTCACAAGAAGCTCCGATCATTTGTCAAAGACCTACATCGAGCAGTATGATCTGTA
CTGTGGAATCATTCAGTGGACCGAGACCGCCACGTCAGCAAACGGCGGTTTTGCCTTCGAGAAAACATCCTAGATCGCCGCCGGTTGAGCCGGATGACTG
CAGGAGTGATTGTGACTCATCGTCTTCTGTTGTTGAAGATGGTGATTGTGAAGGGGGAAATGACAACATCGTTTCTTCATCTCTCAGAAATCCACTGCCT
TTCGATCTCAACTTTCCACCTCCGATGGATGATGTTTATGCTAATTCAAATGATCTTTACTGCACAGCACTATGTCTTTGAAGGAAAATGGTTTCAAAGT
TTCAATCTTTCAATTATATTGAAACACACAAAAAAAATCACAGATTTAAAGCAATTGCTATGAATCTGTTGCTGGAAGAGATTTTAACTCTTCCATTTAC
TTATCCTATTTAATGTCATGGTATTTCATGATAGATGGATTAGTGTCTGACAATTGATCTGATTATGTGTCCTTCAACTATATATGAGTTTTGGGATAAT
GTAGTCTTTTATTGTCAGATTTATATACATTAACATGTAAAATTAGAGGGAACTTTCAGTTCTGTGTTGTACTATTACAATGATAGCTCTAGTGTCGTTG
AATTAAAAAA
>LE_HBa0050P24_SP6_11134 (trimmed for quality and cloning vector)
TGATGCTGCAGCTCGAACTCTTCGTGGACCTAAAGCTAAAACTAATTTCCCTTTACCTATGTACTTTTAGAGGCATCAGTTCTATCGAAGTTTAAACCCT
AATGCTTACCCGGGTGACCCGAGATTGTACTCACAAGAAGCTCCGATCATTTGTCAAAGACCTACATCGAGCAGTATGATCTGTACTGTGGAATCATTCA
GTGGACCGAGACCGCCACGTCAGCAAACGGCGGTTTTGCCTTCGAGAAAACATCCTAGATCGCCGCCGGTTGAGCCGGATGACTGCAGGAGTGATTGTGA
CTCATCGTCTTCTGTTGTTGAAGATGGTGATTGTGAAGGGGGAAATGACAACATCGTTTCTTCATCTCTCAGAAATCCACTGCCTTTCGATCTCAACTTT
CCACCTCCGATGGATGATGTTTATGCTAATTCAAATGATCTTTACTGCACAGCACTATGTCTTTGAAGGAAAATGGTTTCAAAGTTTCAATCTTTCAATT
ATATTGAAACACACAAAAAAAATCACAGATTTAAAGCAATTGCTATGAATCTGTTGCTGGAAGAGATTTTAACTCTTCCATTTACTTATCCTATTTAATG
TCATGGTATTTCATGATAGATGGATTAGTGTCTGACAATTGATCTGATTATGTGTCCTTCAACTATATATGAGTTTTGGGATAATGTAGTCTTTTATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.969849
Expected error %
0.700273
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g50640.1 Score 77 E Value 7e-15 Identity 13.60% Align. Length 461bp (66.05%) Frame 3
68414.m05692 ethylene-responsive element-binding factor 3 (ERF3) identical to SP|O80339 Ethylene responsive element binding factor 3 (AtERF3) [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV54034.1| Score 132 E Value 4e-43 Identity 78.30% Align. Length 507bp (72.64%) Frame 3
ethylene-responsive element binding protein 6 [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q9SXS8|ERF3_TOBAC Score 123 E Value 4e-27 Identity 18.00% Align. Length 461bp (66.05%) Frame 3
Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5) dbj|BAA76734.1| ethylene responsive element binding factor [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0050P24
Clone
Clone name
hba-50p24
LE_HBa0050P24
P050P24
Clone type
BAC
Contamination
none
Estimated length
82,717
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found