Clone Read LE_HBa0198N17_SP6_111624

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0198N17_SP6_111624
Primer
SP6
ID from Seq. Facility
LE_HBa_198_N17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
501 trimmed for vector and quality, 817 raw
Genbank Accession
Sequence
>LE_HBa0198N17_SP6_111624 (raw untrimmed)
TTTATTATGCACAGGTTTGATGGACACTTTTTTTTAAAAATGGTGCCTTCTTAAGAAGTGGTTCACATAACCTCTATGAACTGTTATAAGCATTTTGCAT
GTAAGAAGGAAATTTCGAGCTAGTTCTTTCTTAAGTAAAATACTTGAGCTACTTCAAAGTTCCCAACTATAATAAAAAGGAACAAGCCAATCACTCACCA
GATTTAGCAAGATGCTCCATAAGGACAGTGTATGTGTGGCAGTTGGGAGAACAACCAGATTGAAGCATCTCCTTGTATATCTTGGCTCCTTCCTTAACTC
GATTATGATCAAATAAACCTTTCATGTATGCAGTGTAGCAAACAACATTAGGAGCACATCCTTTATCTTTCATATCCTGCCATAATTTAATTGACTCATT
AATGTCCCCATGGTCGGAAAGCCAGTGAAGAAGGGATGTATACGTCACTGCATCTATCTTGATTTCTTTGTCTTGCATCTGCTGAAAGATATAGTTCATG
GATGAAATCCTCCCAGCTTCCCCAAACATATCCAACATAGTCGTGTAAGGTAAACTGGTCTTGCTTATAGCCTTTTTAACTTATATGCCTAACTGATATA
CATCCATTGCTTTCTCCGTACGAGGATGGGATTTTGAGAACTTGATTTACTGCGAAGGATTGCTGATTTAAGGGAATTTCCTACTATTGTACTTTGAGCA
CAATCTCTATGTTGAAGATTATATATCTGGTTATTGTTGTGTGTAGATTTTATCTCTGTTCGAACAAGTTAACGGCTATAGCATGGTCCCGACATCATCA
CGAGTGCTCCCACGTCT
>LE_HBa0198N17_SP6_111624 (trimmed for quality and cloning vector)
TGGACACTTTTTTTTAAAAATGGTGCCTTCTTAAGAAGTGGTTCACATAACCTCTATGAACTGTTATAAGCATTTTGCATGTAAGAAGGAAATTTCGAGC
TAGTTCTTTCTTAAGTAAAATACTTGAGCTACTTCAAAGTTCCCAACTATAATAAAAAGGAACAAGCCAATCACTCACCAGATTTAGCAAGATGCTCCAT
AAGGACAGTGTATGTGTGGCAGTTGGGAGAACAACCAGATTGAAGCATCTCCTTGTATATCTTGGCTCCTTCCTTAACTCGATTATGATCAAATAAACCT
TTCATGTATGCAGTGTAGCAAACAACATTAGGAGCACATCCTTTATCTTTCATATCCTGCCATAATTTAATTGACTCATTAATGTCCCCATGGTCGGAAA
GCCAGTGAAGAAGGGATGTATACGTCACTGCATCTATCTTGATTTCTTTGTCTTGCATCTGCTGAAAGATATAGTTCATGGATGAAATCCTCCCAGCTTC
C

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957681
Expected error %
0.260675
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g01390.1 Score 141 E Value 2e-34 Identity 19.30% Align. Length 326bp (65.07%) Frame 1
68415.m00056 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g16420.1 Score 79 E Value 1e-15 Identity 11.20% Align. Length 320bp (63.87%) Frame 1
68418.m01919 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD14538.1| Score 142 E Value 5e-33 Identity 19.30% Align. Length 326bp (65.07%) Frame 1
predicted by genscan and genefinder [Arabidopsis thaliana] pir||A84424 hypothetical protein At2g01380 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_178248.2| Score 141 E Value 6e-33 Identity 19.30% Align. Length 326bp (65.07%) Frame 1
pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0198N17
Clone
Clone name
hba-198n17
LE_HBa0198N17
P198N17
Clone type
BAC
Contamination
none
Estimated length
117,330
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found