Clone Read LE_HBa0198N17_T7_111625

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0198N17_T7_111625
Primer
T7
ID from Seq. Facility
LE_HBa_198_N17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
152 trimmed for vector and quality, 904 raw
Sequence
>LE_HBa0198N17_T7_111625 (raw untrimmed)
GGCTCTGGGTCCCGGGGGGATTCTCTAGAGTCGACCTTGCAGGCTCGCAAGCTTAGGCATCGAGCTAAACTAAGTTAATTGGCAATTCATGTTTTTCGTG
TGAACCATTTCTTATTAATTTTCTTGTGCCATTCTCATTGTGTCAAATATTGAGTGTCTATCCATGAAGAAATGATTTTTCGTAGGAGCATTCCCTACCC
CCCCCCCCAACTCATTCCTATCTCAAATGTGCCCTGCATTTCTCTCCAACCCCGGATAATCGTTTTATTTTATTTAGCTTCCTCTTCACTCTATCTATAC
GCGCGTGCTATCGATGACTTTTTTCTCCAGCCATGCTTGCCCACTTCTCTGTGTTCCGTTACTTTTTGTCTTGCAAATCGACTACAATCGGATTGATTGA
TTACGTGTAGTGAGTTTGTTATGCCTTCACCTTTCTGTATATATTCTTAATCTGAGTCTAAGCTGTAAATGATACACAGTTTCTTTTATTTTAGCCCCTC
TGGATAAATAGTCATCTTAATAAAACTATGCTATTCCTTTACATGCTTTATTCTATCCTTACTTCCCCTCTGCTGATTTTCAGCTTATGGTCTTTTTATT
TTAATATTTTTTTTTTTCTCGATCTCTTTTTTATTCGCGTGGGTGTTAGTTATTTAAGTTTTTATATAATAACATTTATATTTCTTCTTTCTCCCTCTTG
CTTTTATTTATCTTTATCTTTTGTTGTCTCTTTCTCTCTCTTAGCTCCCCTTATCTCTCCCATCACCCTCTACTCTNCCACTCTACATTCTCTTAGTCCT
TTCTTCGCCGTCGTATAGCTTCTGCTTACTCTTCTTTATGTCTTCTTTCATCTTCTTATCTCCACTTCTTTTCTTGTATTATATTGTTTTCTTTGCGTTT
TATT
>LE_HBa0198N17_T7_111625 (trimmed for quality and cloning vector)
GGCATCGAGCTAAACTAAGTTAATTGGCAATTCATGTTTTTCGTGTGAACCATTTCTTATTAATTTTCTTGTGCCATTCTCATTGTGTCAAATATTGAGT
GTCTATCCATGAAGAAATGATTTTTCGTAGGAGCATTCCCTACCCCCCCCCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.912787
Expected error %
0.905173
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0198N17
Clone
Clone name
hba-198n17
LE_HBa0198N17
P198N17
Clone type
BAC
Contamination
none
Estimated length
117,330
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found