Clone Read LE_HBa0131O09_SP6_112424

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0131O09_SP6_112424
Primer
SP6
ID from Seq. Facility
LE_HBa_131_O09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
556 trimmed for vector and quality, 942 raw
Genbank Accession
Sequence
>LE_HBa0131O09_SP6_112424 (raw untrimmed)
GGGGTTTTCGGGTTCTCTCAAGANGATGTGCTCGAATTGCTGCTGATATTTCTCGATGTTCTGGTTCAAAAGATGAGAATTTTGACAGTGAGTACGGTGT
TGGTTACAGGACCTCCTGCCCTCGCCAGTTCATTGCAGAGAGTCAAACTTGGTTGAGGTAGTCCATTACAGGACGGCTCTCTTTTGTGAGATGTGCAAGG
TGATCTCGCAAGCTCACTATGAGAGTTTGTAACTTATTGGCATAAGCAGTGTGGAGGGAATCTCATGTTGCTTTGGCGGTGGTTGCATCGGGTACAGTGG
CAGCAAGAGTTGGGTATACTGACTCTAAAATGGCATTTTGTATCAACTAGTCCTGATGAAAGTGAAACCAATTAATGTAATCAAGGTTGGCAATTGTCTG
GTTGTTTTCTGTGGTGGTCTGGATGGGAGCAGTAATAGTCCCATCTACATCCATAAACATTGTGTCCTGTCCTATCATGAGAATGGACATTTGTGCCTTC
CACGGGGAGAGAATAAGTTGTCTGCCAGCAAGTTGATCAAAGGCTAGGTAACTGAGTTGAATTGAACAATGGTGGTGGTATTTGGTGACTGGAATTGGTA
TCAAAGATTGCCTTTTGTGCTACTGGGTACCAGGTGAAAACGGCCGTTTGTACCATAAAAGGTTTATGAATTCGATAATAATCCCCCTTTCTTTCCCTTT
CGCGCGGGCTCTTTCTACTTACCTTACCTTACTTTAACTCTTCTCTCTTGCCGTAATATCCTTCTTCTCCCTCTTGATTAAATAATCACACATATCGTAT
CCTCCTGATTCCTTTTCCTTCTTCGCCCACAGTCCCTATCAGCTCCTATTCACCACGCTTTCTCCTCGTCATCTTCCTCCCCTTCCCCCTATCCATTCCT
CCCTCCCCTCCCCGCGAACGCGAGAATAAACAAAACGAAAAT
>LE_HBa0131O09_SP6_112424 (trimmed for quality and cloning vector)
TGCTCGAATTGCTGCTGATATTTCTCGATGTTCTGGTTCAAAAGATGAGAATTTTGACAGTGAGTACGGTGTTGGTTACAGGACCTCCTGCCCTCGCCAG
TTCATTGCAGAGAGTCAAACTTGGTTGAGGTAGTCCATTACAGGACGGCTCTCTTTTGTGAGATGTGCAAGGTGATCTCGCAAGCTCACTATGAGAGTTT
GTAACTTATTGGCATAAGCAGTGTGGAGGGAATCTCATGTTGCTTTGGCGGTGGTTGCATCGGGTACAGTGGCAGCAAGAGTTGGGTATACTGACTCTAA
AATGGCATTTTGTATCAACTAGTCCTGATGAAAGTGAAACCAATTAATGTAATCAAGGTTGGCAATTGTCTGGTTGTTTTCTGTGGTGGTCTGGATGGGA
GCAGTAATAGTCCCATCTACATCCATAAACATTGTGTCCTGTCCTATCATGAGAATGGACATTTGTGCCTTCCACGGGGAGAGAATAAGTTGTCTGCCAG
CAAGTTGATCAAAGGCTAGGTAACTGAGTTGAATTGAACAATGGTGGTGGTATTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.974554
Expected error %
0.5963
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39281.1| Score 87 E Value 1e-17 Identity 50.50% Align. Length 358bp (64.39%) Frame 2
putative late blight resistance protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38779.1| Score 87 E Value 1e-17 Identity 50.50% Align. Length 358bp (64.39%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0131O09
Clone
Clone name
hba-131o9
LE_HBa0131O09
P131O09
Clone type
BAC
Contamination
none
Estimated length
87,395
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found