Clone Read LE_HBa0131O09_T7_112425

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0131O09_T7_112425
Primer
T7
ID from Seq. Facility
LE_HBa_131_O09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
656 trimmed for vector and quality, 943 raw
Genbank Accession
Sequence
>LE_HBa0131O09_T7_112425 (raw untrimmed)
TTAAGACTGTCCCGGGGGTATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGTGGGTCTGGTTCCCCGGAACCCACTACCTATGTAGTCTAGACACC
CTCAATAGTGTTCTCATCAGCAACAACACTATTAGTAGTGCCTCCCGCTGTGTACACATCTCTGGAGCTAGAATCCCCCGCAGCTGACTTTACAACCCTT
ATCTGACGTGCATTCTCATCTGCAATCGAGGCTCTACTCGTAGCCTCCATGTGACGGCGCTCCTTCTTCCTTTCTCTAGCCTCATCCTCCTCTCGACCCC
TACGCCTCTTGTCATTATCTCAAGGGAGAGGTGGTGGAATCTAAAAAATGGAGCATAAAACCGTCAACACTGTGTCCTCAGCAGGCTGTGTAGAAGGGGC
CTCGAACTCAGGCACCCTAGCCTCTAGGATCATTTAAATATCTGCTCGCAGACTCTAAACCGCAGCCTGAACGGTCGACACGTCCACCAGAGGGGCTGTC
CGAGCTAGCACCCTCAACTCAAAAGCGTCTAAGAATTGATAAACCTCAGTGATCTTCCGCTCTGTGTGCGATTCCATTTTACGCTCCATGCGCTCCTCCG
CCTCAGCAATAGACCTCTGCATCCAAATCTGGATGTGATGCTGAAGTGTGGCCATCAAAGCCTCTAGTTTTCTTGACCCTAGCAAGAGGGACTAGAACGG
GGAAATGGATTGAGCTAAAATGACCTAAGGGAGGTGCCACTACCCCGAATAGACTCAACCAGGGTACGGTCAGTGGGTGCTGACATTGCCCACTGATCTA
TTCTAACTTTTCTATTGTATCTTCTGTAATATCATGCCTGGGAATGTTCCTTTGTCACGGACTTTTATTCGACTCTAACTATGTCATAACTCGATCGTTT
GCTAAACACTAGTTATTTTAAGTTATTTTATACTATTATGAAA
>LE_HBa0131O09_T7_112425 (trimmed for quality and cloning vector)
AGCTTGGTGGGTCTGGTTCCCCGGAACCCACTACCTATGTAGTCTAGACACCCTCAATAGTGTTCTCATCAGCAACAACACTATTAGTAGTGCCTCCCGC
TGTGTACACATCTCTGGAGCTAGAATCCCCCGCAGCTGACTTTACAACCCTTATCTGACGTGCATTCTCATCTGCAATCGAGGCTCTACTCGTAGCCTCC
ATGTGACGGCGCTCCTTCTTCCTTTCTCTAGCCTCATCCTCCTCTCGACCCCTACGCCTCTTGTCATTATCTCAAGGGAGAGGTGGTGGAATCTAAAAAA
TGGAGCATAAAACCGTCAACACTGTGTCCTCAGCAGGCTGTGTAGAAGGGGCCTCGAACTCAGGCACCCTAGCCTCTAGGATCATTTAAATATCTGCTCG
CAGACTCTAAACCGCAGCCTGAACGGTCGACACGTCCACCAGAGGGGCTGTCCGAGCTAGCACCCTCAACTCAAAAGCGTCTAAGAATTGATAAACCTCA
GTGATCTTCCGCTCTGTGTGCGATTCCATTTTACGCTCCATGCGCTCCTCCGCCTCAGCAATAGACCTCTGCATCCAAATCTGGATGTGATGCTGAAGTG
TGGCCATCAAAGCCTCTAGTTTTCTTGACCCTAGCAAGAGGGACTAGAACGGGGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.97977
Expected error %
0.8015
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0131O09
Clone
Clone name
hba-131o9
LE_HBa0131O09
P131O09
Clone type
BAC
Contamination
none
Estimated length
87,395
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found