Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0131O19_SP6_112444

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0131O19_SP6_112444
Primer
SP6
ID from Seq. Facility
LE_HBa_131_O19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
473 trimmed for vector and quality, 992 raw
Genbank Accession
Sequence
>LE_HBa0131O19_SP6_112444 (raw untrimmed)
CCGGGGTTTATTACTTCAGAATTTTAATGTTGATCACAATAATGGAGTCGGTTCCTAGCCCTGGTATTGGCAACCGTTTAGGACAGAGACGAATACGAGA
CTACAAAGACAGAACTCTTTAGGGAA
CTAGTTGATCAATGAGTGCCCTCTAAAGGCTTATTAGTGTTCAGGGTGTCACGTTAATTATATATTCATTTTCA
AGGTATATACAAATGTGCAAGAAAATCTTTACATAGGTAATAAGTGTAGGCCGAACTCATAAGCAGATCCCTAAAATTGTTGGATTTTTTCTTTCAGGTA
TCTCAACTACGTCGTTTTCCTATTGAATCATTGAATTACCCATAATTTGTTCCTTATAAACATTGTTGGCTGATTTTGATCGGCTTTTCTAGTGTAAATG
CCTTCAATTGTGTTTTTATTGTAATGATTCTGATTGAAGGAATGAAGACAAACTGTGTTAGTCTCATTTGTTTTCTACTGTGTTCAGATGACTTGAAGTA
AAACACAATTATTCTTGAACATTTTCACTATCAATTGGACTAATGAGTTCTGGAACAACATATGTATGCTCTATCAATATCCCTCACAAAATCTGTTTCC
ACATCAGCCAACAGTGTTTAAAAGGAAAAAATTTTGGATGGTTCAATGATTCAATAGGAAAATAGCCTTATTGAGATACCCTGAAAAAAAAAACTCACAA
GATTAGGGATCTAATTAAAAATTCGGCCGAAAATTATATTTTTTGTTAACTAACGGTTTAATCCACACCACAGTCTTTCTTGGCTTCGAACTTTATCTTT
CCCCCCTATAATCTAGTAATTTCTTATATTCTCAATCCAATTCTGTTTTCGATTAGCCCCTGCACCGTGACGTCCCTTTTCTCCCGACTTCCCTGGAAAT
TGTTAACAACTCCATTATCCTCTTAATAATACTATATTTTAATTCAAATATTAAAACAATGCTTATTCCAATTCCTCTTCCCTCCATATGTA
>LE_HBa0131O19_SP6_112444 (trimmed for quality and cloning vector)
CTAGTTGATCAATGAGTGCCCTCTAAAGGCTTATTAGTGTTCAGGGTGTCACGTTAATTATATATTCATTTTCAAGGTATATACAAATGTGCAAGAAAAT
CTTTACATAGGTAATAAGTGTAGGCCGAACTCATAAGCAGATCCCTAAAATTGTTGGATTTTTTCTTTCAGGTATCTCAACTACGTCGTTTTCCTATTGA
ATCATTGAATTACCCATAATTTGTTCCTTATAAACATTGTTGGCTGATTTTGATCGGCTTTTCTAGTGTAAATGCCTTCAATTGTGTTTTTATTGTAATG
ATTCTGATTGAAGGAATGAAGACAAACTGTGTTAGTCTCATTTGTTTTCTACTGTGTTCAGATGACTTGAAGTAAAACACAATTATTCTTGAACATTTTC
ACTATCAATTGGACTAATGAGTTCTGGAACAACATATGTATGCTCTATCAATATCCCTCACAAAATCTGTTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.942124
Expected error %
0.5909
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0131O19
Clone
Clone name
hba-131o19
LE_HBa0131O19
P131O19
Clone type
BAC
Contamination
none
Estimated length
94,136
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found