Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0131O19_T7_112445

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0131O19_T7_112445
Primer
T7
ID from Seq. Facility
LE_HBa_131_O19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
668 trimmed for vector and quality, 995 raw
Genbank Accession
Sequence
>LE_HBa0131O19_T7_112445 (raw untrimmed)
CAGAACCGGGACCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGAATTGTCTCTCATTTTCTAAATGTAGCATTTCCAAAAGTGAGAGAA
GAACTTCCATGCAACAATCTGGGTAATTTGCTGGGCAACCATAAGCAACCTTGTTACCCAGGTTTTTTCCACTTTTGGTGTAACGAAATCGTGTCATACC
TCGAGATATCTTGTTATCAACATTTTGGTGCTGAAATTGAAGCCTTCAACTGATTCTCCTTTCTTACGAGATGCATGAAGTTGCTTTCTAACTTGAGTCG
CTAGAGACTGCAGAGGACATAAATAAACAAGGTACTCAGTATTATATTAGTATTATAGAATGTTCAATTACTCAATTTAAGGCATTTTCTTAGAAGTACC
TTTCCTAGCTCCACACCCCACTGATCAAAAGAATTGATACCCCATACGAAGCCTTGGACTGCAACTCTGTGCTCGTAGATGGCCAGTAACTGAAAGAAAG
GAAAGATGATAGCGTTAAGATGAGATTAGGGATCACAAGAAGAGGAATGTGTCTTTACACGAGGATAATTGTCACTACTTGCAGCATGCCACAAAAATGA
AGACAAAGGTCAAGAAGAAAGATATTATCTTGAGAAAACACCCAAATCAAAACAGGAATCTCCTTTAATCAATCATGACAAAGAATGTCTGAGAAAATAT
AACGACCATCTCTCCCATCCTACAGGCAATACTACTACTTGCAAACTCTGTGTCAAGTTTCATCACTGTCAAATATAATTAAAGGTGGCCAAAAAAAATT
CTTCTTTATAGACAAATTGGGAGAACAAGAAAATTATTCCATATTTTTTGATCCTCCTCCATGTGAAAAACTATCGCCAAGATATAGGGATATGGAAATC
TTAATCCATCTCGGGGTTTTTGAATTGTTTTTTAACAAATTGGTGCTTTATTTTATGTCACACGCAGTTCTCCTCTGATATCCATATAATAATTC
>LE_HBa0131O19_T7_112445 (trimmed for quality and cloning vector)
AGCTTGGAATTGTCTCTCATTTTCTAAATGTAGCATTTCCAAAAGTGAGAGAAGAACTTCCATGCAACAATCTGGGTAATTTGCTGGGCAACCATAAGCA
ACCTTGTTACCCAGGTTTTTTCCACTTTTGGTGTAACGAAATCGTGTCATACCTCGAGATATCTTGTTATCAACATTTTGGTGCTGAAATTGAAGCCTTC
AACTGATTCTCCTTTCTTACGAGATGCATGAAGTTGCTTTCTAACTTGAGTCGCTAGAGACTGCAGAGGACATAAATAAACAAGGTACTCAGTATTATAT
TAGTATTATAGAATGTTCAATTACTCAATTTAAGGCATTTTCTTAGAAGTACCTTTCCTAGCTCCACACCCCACTGATCAAAAGAATTGATACCCCATAC
GAAGCCTTGGACTGCAACTCTGTGCTCGTAGATGGCCAGTAACTGAAAGAAAGGAAAGATGATAGCGTTAAGATGAGATTAGGGATCACAAGAAGAGGAA
TGTGTCTTTACACGAGGATAATTGTCACTACTTGCAGCATGCCACAAAAATGAAGACAAAGGTCAAGAAGAAAGATATTATCTTGAGAAAACACCCAAAT
CAAAACAGGAATCTCCTTTAATCAATCATGACAAAGAATGTCTGAGAAAATATAACGACCATCTCTCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.965029
Expected error %
0.9674
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g42740.1 Score 73 E Value 8e-23 Identity 87.20% Align. Length 292bp (43.71%) Frame 1
68418.m05205 glucose-6-phosphate isomerase, cytosolic (PGIC) identical to SP|P34795 Glucose-6-phosphate isomerase, cytosolic (EC 5.3.1.9) (GPI) (Phosphoglucose isomerase) (PGI) (Phosphohexose isomerase) (PHI) {Arabidopsis thaliana}; contains Pfam profile PF00342: glucose-6-phosphate isomerase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU00726.1| Score 71 E Value 4e-25 Identity 82.10% Align. Length 292bp (43.71%) Frame 1
glucose-6-phosphate isomerase [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA61577.1| Score 70 E Value 4e-25 Identity 82.90% Align. Length 304bp (45.51%) Frame 1
glucose-6-phosphate isomerase [Oenothera mexicana] sp|P54243|G6PI_OENME Glucose-6-phosphate isomerase, cytosolic (GPI) (Phosphoglucose isomerase) (PGI) (Phosphohexose isomerase) (PHI)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0131O19
Clone
Clone name
hba-131o19
LE_HBa0131O19
P131O19
Clone type
BAC
Contamination
none
Estimated length
94,136
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found